Supercharge Your Innovation With Domain-Expert AI Agents!

Serratia marcescens

A Serratia marcescens colony technology, applied in the field of microorganisms, can solve the problems of few production methods and identification methods, serious side effects, and poor equipment, so as to improve non-specific immune function, improve quality stability, and avoid toxic and side effects small effect

Inactive Publication Date: 2011-09-14
HEILONGJIANG UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It leads to significant adverse reactions of many drugs with remarkable efficacy and definite curative effect, and the lipopolysaccharide of Shenshenbacterium is the most typical representative. Due to the lack of basic research on production methods and identification methods, a large number of experiments are needed to supplement the preparation. function to make a comprehensive and correct evaluation
In the production process of the domestically produced lipopolysaccharide of the bacterium, the equipment is simple, the production technology is outdated, the quality control is not carried out from the raw material to the extraction process, and at the same time, no attention is paid to the cross-complementation between various disciplines, and the frontier analysis of related disciplines such as pharmacy and immunology Means and concepts are not better for the extraction and pharmacological research of Prodigiocin
At the same time, there are no strict regulations on the stability control of its quality, which seriously breaks the safety, effectiveness and reliability standards of drug use in the clinical application process, resulting in unique efficacy but serious side effects, such as pyrogens and allergies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serratia marcescens
  • Serratia marcescens

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Serratia marcescens ZJH20098 (Serratia marcescens ZJH20098) ZJH20098 has been preserved in the General Microbiology Center of China Committee for the Collection of Microbial Cultures on July 18, 2010. The address is: No. 1, Beichen West Road, Chaoyang District, Beijing, China (100101 ) Tel: 64807355 and the deposit number is: CGMCC No.4010.

[0017] Said Serratia marcescens (Serratia marcescens ZJH20098) ZJH20098 is a highly active strain collected from clinically infected patients, isolated, purified, physically mutagenized, and preferably obtained. After being cultured on solid medium at 28°C for 24 hours, the colony was Rose red, the pigment continuously diffuses into the medium, translucent viscous droplets appear at the beginning of the colony, the colony is round, smooth, moist, the surface is raised with a rose metallic luster, the edges are neat, and there is a foul smell, the colony is cultivated at 37 °C Creamy white.

Embodiment 2

[0019] Said Serratia marcescens (Serratia marcescens ZJH20098) ZJH20098 can utilize citrate and acetate as carbon sources, does not ferment arabinose, and produces a small amount of gas in glucose fermentation experiments; it can also ferment cellobiose, inositol and Glycerol does not produce gas; M.R. is negative and V.P. is positive; BLAST comparison of the 16S rDNA partial sequence shows that it has the main genetic characteristics of Serratia marcescens. Serratia marcescens ZJH20098 was identified by the automatic BD physiological and biochemical identification instrument in the United States, and it has the physiological and biochemical characteristics in the following table.

[0020] Physiological and biochemical identification results

[0021]

[0022]

[0023] The partial sequence of 16s rDNA sequencing is as follows:

[0024] CAGGCTTACACATGCAAGTCGAGCGGTAGCACAGGGGAGCTTGCTCCCNG

[0025] GGTGACGAGCGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGA

[0026] GGGGGATAACTACTG...

Embodiment 4

[0055] A kind of method utilizing described Serratia marcescens to cultivate prodigiocin, the method may further comprise the steps:

[0056] (1) Cultivation of Serratia marcescens: Serratia marcescens strains stored in sealed freezer were activated and expanded on MR plane medium at 29-31°C for 8 hours, then inserted into liquid medium, 29-31 ℃, shaking table 220r / min, culture for 24h, transfer to the above liquid medium according to the inoculum size of 4%, and cultivate for 72h under the same conditions as above, centrifuge the fermentation broth at 3000-4000r / min for 20min, collect the precipitate, and rinse with sterilized distilled water 3 times, shake with 5 times the amount of acetone for 30 minutes, centrifuge, and dry the precipitate at 105°C to constant weight to obtain Serratia marcescens dry powder;

[0057] (2) Preparation of crude product of lipopolysaccharide from Miracle sp.: Weigh the dried Serratia marcescens powder obtained in step (1), grind it with a coll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses serratia marcescens ZJH20098. The officinal bacterium prodigiosum lipopolysaccharide produced at present has serious side effects, such as pyrogen and allergic phenomena. Besides the unspecified process, the main reasons are as follows: the strain is not explicitly stipulated, the mutation is generated by instability, and the functional component change is caused by extraction. The strain provided by the invention is preserved in the China General Microbiological Culture Collection Center (CGMCC) with the preservation number of CGMCC No.4010; and as the strain is collected from the bodies of clinical infected patients, and is a high-activity strain obtained through separation, purification, physical mutagism and optimization, the serratia marcescens ZJH20098 provided by the invention is used as a raw material for producing 'bacterium prodigiosum lipopolysaccharide' for human or livestock use.

Description

Technical field: [0001] The invention relates to a strain of Serratia marcescens in the field of microorganisms. Background technique: [0002] Lipopolysaccharide, formerly known as Prodigiosin prodigiozan (also known as Prodigiosin prodigiozan) [also known as Prodigiosin, Prodigiosin LPS (lipopolysaccharide) formerly used name: Prodigiosin (Hemarisin)] is a gram-negative bacillus serrat marcescens A kind of lipopolysaccharide extracted from the cell wall of Bacteria, also known as the Bacteria cerevisiae. [0003] At the beginning of the research on lipopolysaccharides from Miracle Bacteria, Chinese medicine was in its infancy, and the quality standards of many medicines were not perfect, and the quality control was not strict. It leads to significant adverse reactions of many drugs with remarkable efficacy and definite curative effect, and the lipopolysaccharide of Shenshenbacterium is the most typical representative. Due to the lack of basic research on production method...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12R1/43
Inventor 邹积宏刘红梅
Owner HEILONGJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More