Primer composition, kit and method for detecting mutation of exon 19 of human EGFR gene

A primer composition and exon technology are applied in the field of biotechnology and medicine, can solve the problems of high tumor cell content, cannot be widely promoted, and have multiple tumor tissues, and achieve good reliability, good human-machine interface, The effect of a high degree of automation

Inactive Publication Date: 2011-09-14
宁波基内生物技术有限公司
View PDF8 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with DNA sequencing, although other molecular biology methods have improved sensitivity and / or specificity, most methods still have higher requirements for tissue sampling, requiring more tumor tissues and higher tumor cell content
In addition, some methods, such as fluorescent real-time polymerase chain reaction, high performance liquid chromatography and capillary electrophoresis, require special equipment, so they still cannot be widely promoted in clinical practice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer composition, kit and method for detecting mutation of exon 19 of human EGFR gene
  • Primer composition, kit and method for detecting mutation of exon 19 of human EGFR gene
  • Primer composition, kit and method for detecting mutation of exon 19 of human EGFR gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Determination of EGFR mutation sites to be detected

[0033] According to the report on the study of EGFR mutation in NSCLC patients (source: Dong Qianggang, Han Baohui, Study on gene mutation of EGFR exon 19 in serum cell-free DNA of advanced lung cancer, Chinese Journal of Tumor, 2006, 1: 59-61), it was found that EGFR gene 19 The common mutation types of exon 1 genes are shown in Table 1.

[0034] Table 1 Mutation types of exon 19 of EGFR gene

[0035] mutation type

Nucleic acid sequence (5'-3') 2416-2448

Amino acid sequence (744-754)

Wild type

ATCAAGGAATTAAGAGAAGCAACATCTCCGAAA

LKELREATSPK

Deletion E746-A750 (1)

ATCAA----------------ACATCTCCGAAA

LK-----TSPK

Deletion E746-A750 (2)

ATCAAG---------------ACATCTCCGAAA

LK-----TSPK

Deletion L747-E749insP

ATCAAGGA----------GCAACATCTCCGAAA

LKE---ATSPK

Deletion L747-S752

ATCAAGGA-------------------CCGAAA

LKE------PK

D...

Embodiment 2

[0038] Example 2: The composition and preparation of the kit

[0039] The kit of the present invention is composed of a PCR reaction solution, a mixture of primer combination solutions, a negative control, a positive control and sterilized double distilled water.

[0040] 1. Prepare PCR reaction solution: Tris-HCl (pH 8.4) 40 mM, MgCl 2 15~24mM, KCl 50mM, (NH 4 ) 2 SO 4 10 mM, dNTP 0.5 mM, and the final concentration of Taq DNA polymerase was 0.06-0.10 U / μL. where MgCl 2 The optimal concentration is 20 mM, and the optimal final concentration of Taq DNA polymerase is 0.08 U / μL.

[0041] 2. Prepare the mixed solution of the primer composition: each 10 μM of the primers shown in SEQ ID No:1 and SEQ ID No:2, and the primer shown in 20 μM of SEQ ID No:3 are mixed and prepared, and SEQ ID No: The volume ratio of the primer shown in 1, the primer shown in SEQ ID No:2 and the primer shown in SEQ ID No:3 is 1:1:1;

[0042] 3. Sterilized double distilled water (ddH 2 O);

...

Embodiment 3

[0051] Example 3 : Extraction of DNA from clinical samples

[0052] The scope of application of clinical samples includes surgically resected fresh pathological tissues, paraffin-embedded case tissues, whole blood, plasma, serum, pleural effusion, etc. The DNA extraction kit uses the blood / tissue genome extraction reagent produced by Ningbo Ji Nei Biotechnology Co., Ltd. Kit (registration number: Zheyong Food and Drug Administration (Quasi) Zi 2010 No. 1400013), operate according to the kit instructions. In this example, this kit was used to extract genomic DNA from 1 normal physiological tissue sample and 9 fresh pathological tissue samples of clinical non-small cell lung cancer. Other pathological tissue DNA samples were numbered 2-10 in sequence.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the fields of biotechnology and medical science, and particularly relates to a primer composition, a kit and a method for detecting mutation of an exon 19 of a human epidermal growth factor receptor (EGFR) gene. The primer composition comprises a primer for detecting the mutation of the exon 19 of the human EGFR gene and an upstream primer SEQ ID NO:2 inside the exon 19 of the human EGFR gene, wherein a nucleotide sequence of an upstream primer for detecting the exon 19 of the human EGFR gene is SEQ ID NO:1, a nucleotide sequence of a downstream primer is SEQ ID NO:3. In the primer composition, the mutation of the exon 19 of the human EGFR gene is used as a detection object, and the detection of microfluidic chips is performed on polymerase chain reaction (PCR) products by utilizing a heminested PCR reaction of a special primer group so as to diagnose the mutation of the human EGFR gene quickly, simply, accurately and sensitively.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine, in particular, the invention relates to a primer composition, a kit and a method for detecting mutations in exon 19 of human EGFR gene. Background technique [0002] Lung cancer is a relatively common primary malignant tumor of the lung, with high morbidity and mortality. Male lung cancer accounts for the first cause of various cancer deaths, and female is second only to breast cancer. According to the traditional histopathological classification, lung cancer can be divided into small cell lung cancer and non-small cell lung cancer. Non-small-cell lung cancer (NSCLC) is "non-small cell carcinoma", including squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. Compared with small cell carcinoma, its cancer cells grow and divide slower, and their diffusion and metastasis are relatively slow Later, non-small cell lung cancer accounts for about 80-85% of the total lung cancer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 倪剑锋戚琳玲徐辉杨文辉潘承斌
Owner 宁波基内生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap