Standard molecule simultaneously suitable for specificity detection on seven transgene rape strains
A specific, transgenic technology applied in the biological field
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0150] Embodiment 1, standard molecular construction
[0151] In order to construct general standard molecules suitable for the specific detection of transgenic rapeseed RT73, MS1×RF1, MS1×RF2, MS8×RF3, T45, Oxy235 and Topas19 / 2 lines, MS1-5, RT73-3, RF3-3, RF3 -5, MS8-3, MS8-5, Oxy235-5, Oxy235-3, RF1-5, T45-5, Topas19 / 2-3, RF2-5, HMG, PEP and other 14 specific sequence fragments were gradually cloned into In the pEASY-T3 vector, pCanola9 ( figure 1 ), the size is about 7921bp. The results of three times of plasmid whole gene sequencing were consistent with the target sequence.
[0152] MS1-5 (SEQ ID NO: 1, 299bp):
[0153] GGCCTGTGGTCTCAAAGATGGATCATTAATTTCCACCTTCACCTACGATGGGGGGCATCGCACCGGTGAGTAATATTGTACGGCTAAGAGCGAATTTGGCC TGTAGACCTCAATTGCGAGCTTTCTAATTCAAACTATTCGGGCCTAACTTTTGGTGTGATGATGCTGAAGAACCTATCCATGAAACTCACAAAAACATC
[0154] RT73-3 (SEQ ID NO: 2, 316bp):
[0155] CGACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATAACGCTGCGGACATCTACATTTTTGAATTGAAAAAGAATTGGTAATTACTCTT...
Embodiment 2
[0182] Embodiment 2, standard molecule is used for the applicability identification of ordinary PCR detection
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com