Compositions and methods for modulating collagen and smooth muscle actin expression by serpine2
An actin, smooth muscle technology, applied in chemical instruments and methods, drug combinations, immunoglobulins, etc., can solve problems such as no drug therapy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0201] Example 1: Effect of purified SERPINE2 protein on RNA expression
[0202] The effect of SERPINE2 on lung fibroblasts was assessed by incubating normal human lung fibroblasts (NHLF) in fibroblast growth medium. Harvest NHLF cells. Cells were then pelleted, resuspended in growth medium, dispensed at 200ul per well at 8000 cells per well, and incubated at 37°C, 5% CO 2 Incubate for 6 hours. 6 hours after dispensing, cells were serum starved by removing complete growth medium and adding 200 ul starvation medium (Clonetics Fibroblast Basal Medium (FBM) (Lonza Cat. #CC-3131 ) + 0.5% BSA fraction to cells V) and at 37°C, 5% CO 2 Incubate for 16-24 hours.
[0203] Starvation medium was removed from the cells and 75ul of co-treatment was added immediately followed by 75ul of protein treatment. Co-treatments were starvation medium and TGF-β1 or IL-13 added at one of three doses, TGF-low treatment was 0.1 ng / ml TGF-β1 (final concentration in the experiment was 0.05 ng / ml); TG...
Embodiment 2
[0206] Example 2: Generation of constructs expressing wild-type SERPINE2
[0207] Constructs containing the nucleotide sequence of wild-type SERPINE2 DNA and expressing wild-type SERPINE2 protein were generated.
[0208] The nucleotide sequence of wild-type SERPINE2 DNA is:
[0209] atgaactggcatctccccctcttcctcttggcctctgtgacgctgccttccatctgctcccactt
[0210] caatcctctgtctctcgaggaactaggctccaacacggggatccaggttttcaatcagattgtga
[0211] agtcgaggcctcatgacaacatcgtgatctctccccatgggattgcgtcggtcctggggatgctt
[0212] cagctgggggcggacggcaggaccaagaagcagctcgccatggtgatgagatacggcgtaaatgg
[0213] agttggtaaaatattaaagaagatcaacaaggccatcgtctccaagaagaataaagacattgtga
[0214] cagtggctaacgccgtgtttgttaagaatgcctctgaaattgaagtgccttttgttacaaggaac
[0215] aaagatgtgttccagtgtgaggtccggaatgtgaactttgaggatccagcctctgcctgtgattc
[0216] catcaatgcatgggttaaaaacgaaaccagggatatgattgacaatctgctgtccccagatctta
[0217] ttgatggtgtgctcaccagactggtcctcgtcaacgcagtgtatttcaagggtctgtggaaatca
[0218] cggttccaacccgagaacacaaagaa...
Embodiment 3
[0236] Example 3: Generation of SERPINE2 muteins that do not bind LRP
[0237] A construct containing the nucleotide sequence of a SERPINE2 mutein that is unable to bind low-density lipoprotein receptor-related protein (LRP) was generated. This mutein contains the following mutations at amino acid positions 48 and 49 of SERPINE2: H48A and D49E.
[0238] The DNA nucleotide sequence of the LRP-binding mutein of SERPINE2 is:
[0239] atgaactggcatctccccctcttcctcttggcctctgtgacgctgccttccatctgctcc
[0240] cacttcaatcctctgtctctcgaggaactaggctccaacacggggatccaggttttcaat
[0241] cagattgtgaagtcgaggcctgcagaaaacatcgtgatctctccccatgggattgcgtcg
[0242] gtcctggggatgcttcagctgggggcggacggcaggaccaagaagcagctcgccatggtg
[0243] atgagatacggcgtaaatggagttggtaaaatattaaagaagatcaacaaggccatcgtc
[0244] tccaagaagaataaagacattgtgacagtggctaacgccgtgtttgttaagaatgcctct
[0245] gaaattgaagtgccttttgttacaaggaacaaagatgtgttccagtgtgaggtccggaat
[0246] gtgaactttgaggatccagcctctgcctgtgattccatcaatgcatgggttaaaaacga...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
