Method for analyzing exogenous gene flow risk of human antithrombinIII transgenic sheep
A technology of transgenic sheep and antithrombin, applied in the field of risk analysis of exogenous gene drift, can solve problems that have not been taken seriously
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1 Design of primers and Taqman probes
[0069] Use Primer Primer 5.0 software to analyze the sequence of the human ATIII gene (NM_000488), design and synthesize human ATIII-specific primers for the construction of standard plasmids (F: 5'-gtgataggaactgtaacct-3'; R: 5'-cggccagcaatcacaacag-3') . Taqman probes and primers were designed using Primer Express 3.0 software from Applied Biosystems (F: 5'-TGTGATAGGAACTGTAACCTCTGG-3'; R: 5'-GCTTGGCTGTGCAGATGTC-3'; Taqman probe: 5'-(FAM)TGTCCTTGCTGCTCATTGGCTTCTG (Eclipse) -3'). The specificity of designed primers and probe sequences was analyzed by BLAST online software. The primers and probes were synthesized by Dalian Takara Company.
Embodiment 2
[0070] Example 2 Preparation, DNA Amplification and Cloning of Blood Genomic DNA
[0071] 1. The blood samples were anticoagulated with EDTA, and the blood was stored in a 1.5ml centrifuge tube at 4°C for later use. Blood genome was extracted using QIAGEN Spin Column Blood Genome Extraction Kit.
[0072] 2. Amplification of transgenic sheep ATIII gene
[0073] The blood genome of transgenic ATIII sheep (trial number A22) was used as a template.
[0074] The PCR amplification system is as follows:
[0075] 25μl system, DNA template 3μl, 10×Ex Taq buffer 2.5μl, dNTP (2.5mM) 2.5μl, primer F (10pM), primer R (10pM), Taq enzyme 0.2μl, ddH 2 O to make up to 25 μl. The reaction conditions were 94°C for 5min; 95°C for 30S, 55°C for 30S, 72°C for 1.5min, 25 cycles; 72°C for 10min. The size of the amplified fragment was 1263bp, and the amplification effect was analyzed by 1% agarose gel electrophoresis and recovered.
[0076] 3. Cloning of transgenic sheep ATIII gene
[0077] Use...
Embodiment 3
[0080] 5 Example 3 Fluorescent quantitative PCR detection and analysis
[0081] 1. Fluorescent quantitative PCR detection
[0082] The 25 μl reaction system includes 12.5 μl of TaqMan Universal PCR Master Mix buffer, 10 ng of blood sample DNA template, the concentration of primers and probes is added according to the specific experiment, and the system uses ddH 2 O (double distilled water) to make up. The specific reaction conditions are two temperature cycles (95°C 10min; 95°C 15s, 60°C 1min, 40cycle). Optimum usage of primers and probes was screened by matrix method.
[0083] 2. Sensitivity evaluation and quantitative analysis
[0084] The RNA standard product was serially diluted by 1 / 10, and the established detection system was used to perform fluorescent quantitative PCR detection on the RNA standard product of different concentrations to determine the detection sensitivity. At the same time, the standard curve is obtained by detecting the amplification curve with the...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com