Primer, probe, reagent kit and method for detecting mutation of BRAF gene V600E
A detection method and detection primer technology, which are applied in the field of biomedical clinical molecular detection, can solve the problems of long cycle, cumbersome data analysis process, and low sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Example 1. Design of primers and probes:
[0081] According to the BRAF gene reference sequence (NG_007873.2) released by the National Center for Biotechnology Information NCBI's nucleic acid sequence database GeneBank and the BRAF gene V600E mutation (dbSNP: rs113488022) information released by the dbSNP database, the Primer Express 3.0 software of ABI was used to design The primers and probes for detecting the V600E mutation of the BRAF gene are as follows:
[0082] Detection forward primer: 5'- AAATAGGTGATTTTGGTCTAGCTACACA -3';
[0083] Detection reverse primer: 5'- CTTTCTAGTAACTCAGCAGCATC -3';
[0084] Detection fluorescent probe: 5'FAM-TCCCATCAGTTTGAACAGTTGTCT-3'Dabcyl.
[0085] In order to monitor the effectiveness of the reaction system, internal control primers and probes are added to the detection system. The present invention selects a conserved sequence of the human gene GAPDH (its GeneBank reference sequence number is: NG_007073.2), and uses the Primer Exp...
Embodiment 2
[0089] Example 2. Preparation of primers
[0090] Send the designed primers and probe sequences to the synthesis company for synthesis. Generally, automatic chemical synthesis is used with instruments, and a synthesis inspection report is required.
Embodiment 3
[0091] Example 3. Preparation of a fluorescent PCR kit for detecting BRAF gene V600E mutation
[0092] Prepare a specific reaction solution for detecting the BRAF gene V600E mutation. The PCR reaction solution includes not only buffers, magnesium ions, dNTPs and other substances necessary for PCR reactions, but also mutation detection primers and probes and internal control primers and probes. The concentration of each component of the mutation detection PCR reaction solution and the sequence information of the included primers and probes are as follows:
[0093] Table 1. PCR reaction solution components
[0094] Reaction solution components concentration buffer 10× Magnesium ions 15mM dNTPs (A / T / G / C) 20mM each Upstream Detection Primers 2μM Downstream Detection Primers 2μM detection signal probe 2μM upstream internal control primer 1μM downstream internal control primer 1μM Internal control signal probe ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 