Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer, probe, reagent kit and method for detecting mutation of BRAF gene V600E

A detection method and detection primer technology, which are applied in the field of biomedical clinical molecular detection, can solve the problems of long cycle, cumbersome data analysis process, and low sensitivity

Inactive Publication Date: 2012-12-12
SUZHOU KUANGYUAN MOLECULAR BIOTECH
View PDF3 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The present invention aims at the deficiencies such as low sensitivity, long period, and complicated data analysis process when detecting BRAF gene mutation in the prior art, and provides a primer, probe, kit and method for detecting BRAF gene mutation based on a real-time fluorescent quantitative PCR technology platform , used to detect BRAF gene V600E mutation, the invention is fast, low in cost, and has the value of clinical detection and promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, probe, reagent kit and method for detecting mutation of BRAF gene V600E
  • Primer, probe, reagent kit and method for detecting mutation of BRAF gene V600E
  • Primer, probe, reagent kit and method for detecting mutation of BRAF gene V600E

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0080] Example 1. Design of primers and probes:

[0081] According to the BRAF gene reference sequence (NG_007873.2) released by the National Center for Biotechnology Information NCBI's nucleic acid sequence database GeneBank and the BRAF gene V600E mutation (dbSNP: rs113488022) information released by the dbSNP database, the Primer Express 3.0 software of ABI was used to design The primers and probes for detecting the V600E mutation of the BRAF gene are as follows:

[0082] Detection forward primer: 5'- AAATAGGTGATTTTGGTCTAGCTACACA -3';

[0083] Detection reverse primer: 5'- CTTTCTAGTAACTCAGCAGCATC -3';

[0084] Detection fluorescent probe: 5'FAM-TCCCATCAGTTTGAACAGTTGTCT-3'Dabcyl.

[0085] In order to monitor the effectiveness of the reaction system, internal control primers and probes are added to the detection system. The present invention selects a conserved sequence of the human gene GAPDH (its GeneBank reference sequence number is: NG_007073.2), and uses the Primer Exp...

Embodiment 2

[0089] Example 2. Preparation of primers

[0090] Send the designed primers and probe sequences to the synthesis company for synthesis. Generally, automatic chemical synthesis is used with instruments, and a synthesis inspection report is required.

Embodiment 3

[0091] Example 3. Preparation of a fluorescent PCR kit for detecting BRAF gene V600E mutation

[0092] Prepare a specific reaction solution for detecting the BRAF gene V600E mutation. The PCR reaction solution includes not only buffers, magnesium ions, dNTPs and other substances necessary for PCR reactions, but also mutation detection primers and probes and internal control primers and probes. The concentration of each component of the mutation detection PCR reaction solution and the sequence information of the included primers and probes are as follows:

[0093] Table 1. PCR reaction solution components

[0094] Reaction solution components concentration buffer 10× Magnesium ions 15mM dNTPs (A / T / G / C) 20mM each Upstream Detection Primers 2μM Downstream Detection Primers 2μM detection signal probe 2μM upstream internal control primer 1μM downstream internal control primer 1μM Internal control signal probe ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer, a probe, a reagent kit and a method for detecting mutation of BRAF gene V600E on the basis of real-time fluorescent quantitative PCR (polymerase chain reaction) technical platform. The primer, the probe, the reagent kit and the method are quick and low in cost and have clinic detection popularization value.

Description

technical field [0001] The invention belongs to the field of biomedical clinical molecular detection, and in particular relates to primers, probes, kits and usage methods for detecting BRAF gene V600E mutations. Background technique [0002] The BRAF gene is an oncogene, which belongs to the RAF family together with the ARAF and RAF1 (CRAF) genes, and the BRAF protein encoded by it is a serine / threonine-specific kinase that is involved in the RAS-RAF-MEK-ERK-MAPK signaling pathway. It is an important transduction factor involved in the regulation of various biological events in cells, such as cell growth, differentiation and apoptosis. [0003] The BRAF gene is located at 7q34, about 190kb in length, and the transcribed mRNA is 2.5kb in length, encoding a protein of 783 amino acids with a relative molecular mass of 94,000-95,000. The BRAF protein consists of 783 amino acids, functionally from the N-terminal to the C-terminal are the RAS binding region, the cysteine-rich reg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 王进赵小龙何晓辉刘乔陈允斌
Owner SUZHOU KUANGYUAN MOLECULAR BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More