Kit for detecting polymorphism of VKORC1 and CYP2C9 genes
A gene polymorphism and kit technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of individual differences in warfarin dosage and limited influence of non-genetic factors. , to achieve high accuracy, good specificity, and low false positives
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1 Preparation of kit of the present invention
[0033] The kit of the present invention consists of the following:
[0034] (1) Human peripheral blood genome extraction reagents are: deionized water, 6M NaI, chloroform / isoamyl alcohol (24:1) mixture, isopropanol and absolute ethanol.
[0035] (2) Primers:
[0036] 1) VKORC1 exon 3 gene
[0037] The upstream primer sequence is: 5′-CAGTGCCTGAAGCCCACA-3′,
[0038] The downstream primer sequence is: 5'-CTCACATGCCAAAGCAAAGC -3';
[0039] 2) CYP2C9 exon 3 gene
[0040] The upstream primer sequence is: 5'-GCTGTTAAGGGAATTTGTAGG-3',
[0041] The sequence of the downstream primer is: 5'-ATATTCACCCAAGGCTGTCT-3';
[0042] 3) CYP2C9 exon 7 gene
[0043] The upstream primer sequence is: 5'-GTGCCATTTTTCTCCTTTTCC -3',
[0044] The downstream primer sequence is: 5'- AATGTCACAGGTCACTGCATG -3'.
[0045] The above primer sequences were synthesized by Shanghai Life Technology Biotechnology Company.
[0046] (3) Negat...
Embodiment 2
[0055] Example 2 Using the kit prepared in Example 1 to detect the gene polymorphisms of VKORC1 and CYP2C9
[0056] Take the results of detecting the gene polymorphisms of VKORC1 and CYP2C9 in the peripheral blood samples of 20 patients who need to use warfarin as an example.
[0057] Detection process: First, design specific primers based on the VKORC1 and CYP2C9 gene sequences provided by the NCBI nucleic acid database. Obtain peripheral blood samples from patients who are clinically using warfarin drugs, use whole blood DNA extraction reagents to extract peripheral blood DNA, prepare PCR reaction solution for PCR amplification, then recover PCR amplification products, perform sequencing reactions, and sequence reactions after completion After the product was purified, it was sequenced, and finally the nucleic acid sequence was compared in the NCBI nucleic acid database to determine the sequence polymorphism.
[0058] Specific steps are as follows:
[0059] (1) Extract...
Embodiment 3
[0069] Embodiment 3 Evaluation of the detection ability of the kit of the present invention
[0070] According to the utilization example 1, the detection kit (gene sequencing method) was used to detect the peripheral blood of 45 cases of patients who had been treated with warfarin and had been detected by the liquid-phase chip method. Experiments show that the sensitivity, specificity and sensitivity of this kit are more accurate than the liquid chip method, and fully meet the practical requirements of current clinical diagnosis and treatment:
[0071] Table 2 Comparison of VKORC1 and CYP2C9 gene polymorphisms detected by two methods
[0072]
[0073] in:
[0074] (1) Specificity: 100%;
[0075] (2) Sensitivity: 100%;
[0076] (3) Positive predictive value: the positive predictive value reaches 100%;
[0077] (4) Negative predictive value: the negative predictive value reaches 100%;
[0078] (5) Repeatability: The results of repeated experiments are consistent;
[...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 