Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lentivirus method for preparing IGF2b transgenic fish

A lentivirus, transgenic technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, genetic engineering, etc.

Inactive Publication Date: 2012-02-29
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In my country, Zhu Zuoyan and others obtained transgenic carp with grass carp growth hormone through microinjection. Carp has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lentivirus method for preparing IGF2b transgenic fish
  • Lentivirus method for preparing IGF2b transgenic fish
  • Lentivirus method for preparing IGF2b transgenic fish

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0037] The present invention will be further described below in conjunction with embodiment.

[0038] (1) Take the construction of IGF2b gene transgenic carp as an example: according to the Genbank accession number of the carp IGF2b gene cDNA sequence as AF402958, design primers

[0039] IGF2b-BamHI-F,GATCATACGGATCCGCCACCATGGAGGACCAACTAAAACATCA

[0040] IGF2b-NheI-R,CAGTTGACGCTAGCTCATCGACTCTGTGCAAAAAGG),扩增其CDS区ATGGAGGACCAACTAAAACATCATTCTTTGTGCCATACTTGTTTGAGAACAGACAGTGTCATAAATAAGGTCATAAAGATGTACTGGTCCATACGAATGCCCATATGCATACTGTTTTTAACCCTGTCTGCCTTCGAAGTGGCTTCAGCTGAAACGTTATGCGGCGGAGAGCTGGTGGACGCGCTACAGTTTGTGTGTGGAGACAGAGGTTTCTATTTCAGTCGACCAACTAGCAGGTTGAGCAGTCGACGTTCTCAAAATCGTGGGATTGTGGAAGAGT

[0041] GTTGTTTTAACAGTTGTAACCTAGCTCTTCTAGAACAGTACTGCGCTAAACCTGCCAAGTCAGAGAGGGACGTTTCAGCCACATCCCTACAGGTCATCCCGGTGATGCCCACATTAAAACAGGAGGTCCCAAGAAAACATGTGACCGTGAAATATTCCAAATACGACATGTGGCAACGAAAGGCCGCCCAGAGGCTACGGAGGGGCGTCCCCGCCATCCTGCGGGCCAAGAAGTTTAGGCGGCAGGCGGAGAGAATCAGGGCCCAAGAGCAACTGCACCACCACAGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lentivirus method for preparing IGF2b transgenic fish. The method is characterized in that: the production of the transgenic fish is carried out by establishing lentivirus vectors containing target genes; the vectors contain GFP reporter genes which can be used for testing the transgene effect. The method provided by the invention is used for producing lentivirus transgenic fish. The survival rate of the transgenic fish is 12.2%.

Description

technical field [0001] The invention relates to a lentiviral method for preparing IGF2b transgenic fish. Background technique [0002] At present, methods for producing transgenic animals include pronuclear intranuclear microinjection, sperm carrier method, liposome transfection method, retroviral vector method, and cell nucleus transfer method, but these methods are all due to high cost, low transgenic efficiency or Shortcomings such as small insert fragments cannot be widely used. The emergence of the lentiviral vector method not only overcomes the defects of expression silencing of retroviruses in the past, but also has a much higher transgenic efficiency than the traditional microinjection method, which is a breakthrough in the field of transgenic animal research. Subsequently, using this method, transgenic pigs, transgenic cattle, transgenic mice, transgenic chickens, sheep, macaques, etc. have been born. [0003] In my country, Zhu Zuoyan and others obtained transgen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867A01K67/027
Inventor 张成锋董在杰朱健邴旭文苏胜彦
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com