Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp

A technology of grass carp hemorrhagic disease and oral vaccines, which is applied in the field of preparing oral vaccines for grass carp hemorrhagic disease, can solve the problems that no oral vaccines for grass carp hemorrhagic disease have been prepared, achieve significant immune effects, simple preparation process, and low cost

Inactive Publication Date: 2014-08-20
SUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no report on the preparation of an oral vaccine against grass carp hemorrhagic disease using the silkworm baculovirus expression vector system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp
  • Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp
  • Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment one: the preparation of silkworm larva expressing grass carp hemorrhagic disease virus (GCRV) VP6

[0042] 1. Use QIAGEN Viral RNA Mini Kit (Qiagen Company) to extract the genome RNA of grass carp hemorrhagic disease virus, use RNA PCR KitVer. cDNA coding sequence (GenBank accession number: AF403394) designed primers GCRV-EI-6 (GGCGAATTC ATGGCACAGCGTCAGTTTTTCGG, the underline indicates the EcoRI restriction site) and GCRV-HD-6 (TCGAAGCTTAGACGAACATCGCCTGCGC, the underline indicates the Hind III restriction site), and synthesized by PCR The coding sequence of VP6 gene with EcoRI and HindⅢ sites at the 5' end and 3' end respectively was cloned into T-vector to obtain pMD19T-VP6 plasmid.

[0043] 2. Digest the pMD19T-VP6 plasmid with EcoRI / HindⅢ double enzyme digestion, recover the VP6 gene fragment (1.23 kb), digest the donor plasmid pFastBac-Dual with EcoRI / HindⅢ double enzyme digestion, recover the pFastBac-Dual fragment, and insert the VP6 gene fragment Betw...

Embodiment 2

[0053] Embodiment two: the preparation of silkworm chrysalis expressing grass carp hemorrhagic disease virus (GCRV) VP6

[0054] 1. Use the P3 generation recombinant virus BmNPV-IIVP6 obtained in step 7 of Example 1 to infect BmN cultured cells, and collect the cell culture supernatant after 4 days.

[0055] 2. Take the cell culture supernatant of step 1 with an insect needle, puncture at the link to pick up silkworm pupae about 2 days old, protect them at about 25°C for 5 days, take a small amount of pupal blood, and perform SDS-PAGE and Western blotting tests, and The expression level of VP6 was estimated by grayscale analysis on SDS-PAGE gel. The results showed that the molecular weight of the recombinant VP6 protein was about 53kD, and the expression level of VP6 protein was the highest after 5 days of infection, accounting for about 5.5% of the total protein in pupal hemolymph. The silkworm pupae were collected 5 days after virus inoculation and stored at -20°C.

Embodiment 3

[0056] Embodiment three: the preparation of expressing VP6 silkworm chrysalis freeze-dried powder

[0057]1. Get 10 kg of silkworm chrysalis in step 2 of Example 2, homogenize in an ice bath, add 40 kg of 0.7% physiological saline, mix, and filter with gauze to remove coarse impurities.

[0058] 2. Freeze-dry the filtrate until the water content is less than 2%, crush and sieve to make powder raw materials.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of an orally-taken vaccine for treatment of hemorrhage of a grass carp, which comprises the following steps of: (1) preparing a recombinant baculovirus BmNPV-IIVP6 with hemorrhagic virus structure protein VP6 genes of the grass carp in a genetic engineering method; (2) grafting the amplified recombinant baculovirus BmNPV-IIVP6 to a five-instar silkworm larvae or pupae; (4) collecting the silkworm larvae or pupae subjected to virus inoculation after 4 to 6 days, and preparing freeze-dried powder in a freeze-drying method; and (4) mixing the freeze-dried powder prepared in Step (3) and powdered fish feed, to obtain the orally-taken vaccine for treatment of hemorrhage of the grass carp. The content of the freeze-dried powder in the orally-taken vaccine for treatment of hemorrhage of the grass carp is 1-10 percent by weight. The vaccine can be directly used as an orally-taken vaccine, and has the advantages of simple preparation process, low cost, convenient use and dual functions of protein subunit vaccines and nucleic acid vaccines.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for preparing an oral vaccine against grass carp hemorrhagic disease by using a silkworm bioreactor. Background technique [0002] grass carp( Ctenopharyngodon idellus ) is the main species of freshwater fish farming in my country, and its output accounts for about 20% of the total freshwater aquaculture output. However, grass carp suffers from many diseases, among which hemorrhagic disease of grass carp is the most severe, caused by grass carp hemorrhagic disease virus ( Grass Carp Reovirus, GCRV). This disease is the biggest disease in the breeding stage of fish fingerlings, and the mortality rate is as high as more than 90%, which has caused huge losses to the aquaculture industry. [0003] In the prior art, formaldehyde inactivated vaccines are mainly used in the immune prevention of grass carp hemorrhagic disease. For example, the dead grass carp infected wi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/15A61P31/14C12N15/46C12N7/01C12N15/866
Inventor 贡成良薛仁宇曹广力陈辉刘林徐诗英邹勇
Owner SUZHOU UNIV