Preparation method of orally-taken vaccine for treatment of hemorrhage of grass carp
A technology of grass carp hemorrhagic disease and oral vaccines, which is applied in the field of preparing oral vaccines for grass carp hemorrhagic disease, can solve the problems that no oral vaccines for grass carp hemorrhagic disease have been prepared, achieve significant immune effects, simple preparation process, and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Embodiment one: the preparation of silkworm larva expressing grass carp hemorrhagic disease virus (GCRV) VP6
[0042] 1. Use QIAGEN Viral RNA Mini Kit (Qiagen Company) to extract the genome RNA of grass carp hemorrhagic disease virus, use RNA PCR KitVer. cDNA coding sequence (GenBank accession number: AF403394) designed primers GCRV-EI-6 (GGCGAATTC ATGGCACAGCGTCAGTTTTTCGG, the underline indicates the EcoRI restriction site) and GCRV-HD-6 (TCGAAGCTTAGACGAACATCGCCTGCGC, the underline indicates the Hind III restriction site), and synthesized by PCR The coding sequence of VP6 gene with EcoRI and HindⅢ sites at the 5' end and 3' end respectively was cloned into T-vector to obtain pMD19T-VP6 plasmid.
[0043] 2. Digest the pMD19T-VP6 plasmid with EcoRI / HindⅢ double enzyme digestion, recover the VP6 gene fragment (1.23 kb), digest the donor plasmid pFastBac-Dual with EcoRI / HindⅢ double enzyme digestion, recover the pFastBac-Dual fragment, and insert the VP6 gene fragment Betw...
Embodiment 2
[0053] Embodiment two: the preparation of silkworm chrysalis expressing grass carp hemorrhagic disease virus (GCRV) VP6
[0054] 1. Use the P3 generation recombinant virus BmNPV-IIVP6 obtained in step 7 of Example 1 to infect BmN cultured cells, and collect the cell culture supernatant after 4 days.
[0055] 2. Take the cell culture supernatant of step 1 with an insect needle, puncture at the link to pick up silkworm pupae about 2 days old, protect them at about 25°C for 5 days, take a small amount of pupal blood, and perform SDS-PAGE and Western blotting tests, and The expression level of VP6 was estimated by grayscale analysis on SDS-PAGE gel. The results showed that the molecular weight of the recombinant VP6 protein was about 53kD, and the expression level of VP6 protein was the highest after 5 days of infection, accounting for about 5.5% of the total protein in pupal hemolymph. The silkworm pupae were collected 5 days after virus inoculation and stored at -20°C.
Embodiment 3
[0056] Embodiment three: the preparation of expressing VP6 silkworm chrysalis freeze-dried powder
[0057]1. Get 10 kg of silkworm chrysalis in step 2 of Example 2, homogenize in an ice bath, add 40 kg of 0.7% physiological saline, mix, and filter with gauze to remove coarse impurities.
[0058] 2. Freeze-dry the filtrate until the water content is less than 2%, crush and sieve to make powder raw materials.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
