Constitutive expression promoter and application thereof
A technology of constitutive expression and promoter, applied in the field of plant biology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0028] The methods used in the following examples are conventional methods unless otherwise specified. The primers used were synthesized by Shanghai Yingjun Biotechnology Co., Ltd., and the sequencing was completed by Beijing Huada Gene. Zibao Bioengineering Co., Ltd., pEASY-T1 ligation kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd., and T4 DNA ligase was purchased from Promega Company. The methods were all carried out according to the methods provided in the kit. The carrier pHPG used in the experiment was transformed from this experiment, and the basic skeleton came from pCAMBIA1303 of CAMBIA Company.
[0029] 1. Isolation and Characterization of Promoter KT632P
[0030] Design the primers required for cloning the promoter KT632P:
[0031] Primer 1: 5'-ggatcc ATACAACAGGAGGACAACATCTGG -3'
[0032] Primer 2: 5'-gaattc GCTACAACTACAAGTGCAACTTACAA -3'
[0033] The sequence ggatcc in primer 1 is the restriction site for BamHI, and the sequence gaattc i...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com