Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Identifying method for sunflower phoma black stem bacteria

An identification method, sunflower technology, applied in the identification field of sunflower black stem fungus, can solve problems such as yield reduction, plant lodging and death, flower disc dryness, etc.

Active Publication Date: 2014-07-16
INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The black lesions have clear edges, and in severe cases, they can surround the stems, causing the plants to fall and die. On the surface of the stems, small black pycnidia appear, and on the back of the flower disc, brown lesions are produced. The flower discs are dry and small, and the grains cannot be filled normally. cause serious production cuts

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identifying method for sunflower phoma black stem bacteria
  • Identifying method for sunflower phoma black stem bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] First of all, since sunflower black stem disease has only been reported in Xinjiang, we first identified the disease samples collected in other sunflower growing areas by traditional Koch's rule combined with PCR to confirm that the collected disease samples were black stem disease caused by Phoma macdonaldi .

[0017] Synthetic primers:

[0018] F-primer CAAACTGACCATTTCTAGC (forward);

[0019] R-primer AGGGATCCACTCGACGAAGT (reverse);

[0020] Extract DNA from sunflower seeds or diseased plants, and use synthetic primers to carry out PCR amplification. The PCR is carried out using steps known in the art, and then the amplified product is subjected to gel electrophoresis. display, as attached figure 1 As shown, it means that the sunflower seeds or diseased plants are infected with black stem disease, and this method can specifically identify black stem disease. The method can be used to detect sunflower seeds carrying bacteria to control the long-distance spread of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an identifying method for sunflower phoma black stem bacteria. According to the identifying method, specific primers are adopted to amplify sunflower DNA, wherein the sunflower phoma black stem can be specifically identified with the method. With the method of the present invention, fungal detection can be performed on sunflower seeds, such that long distance spread of the sunflower phoma black stem can be controlled; and early and rapid identification of attacked plants in fields is an important link for controlling disease extension and spread.

Description

technical field [0001] The invention relates to a method for identifying pathogens, in particular to an identification method for sunflower black stem pathogens. Background technique [0002] Sunflower Phoma black stem (Sunflower Phoma black stem) is an important and devastating fungal disease carried by seeds on sunflowers, and it is also a quarantine disease in my country. The pathogenic bacteria causing the disease are Leptosphaeria lindquistii belonging to the Ascomycota subphylum Microglobules in a sexual form, and Phoma macdonaldii belonging to the Deuteromycotina subphylum Phoma in the anamorphic state. Sunflower black stem fungus can infect sunflowers throughout their growing seasons. The most typical symptom of the disease is that the lesion first occurs at the base of the petiole, and rapidly expands to the stem, forming a black oval lesion, causing the leaves to wilt and dry. The black lesions have clear edges, and in severe cases, they can surround the stems, c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 赵君周洪友景岚娜仁张之为侯亚光石必显雷中华王玉杰曹雄
Owner INNER MONGOLIA AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com