Identifying method for sunflower phoma black stem bacteria
An identification method, sunflower technology, applied in the identification field of sunflower black stem fungus, can solve problems such as yield reduction, plant lodging and death, flower disc dryness, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] First of all, since sunflower black stem disease has only been reported in Xinjiang, we first identified the disease samples collected in other sunflower growing areas by traditional Koch's rule combined with PCR to confirm that the collected disease samples were black stem disease caused by Phoma macdonaldi .
[0017] Synthetic primers:
[0018] F-primer CAAACTGACCATTTCTAGC (forward);
[0019] R-primer AGGGATCCACTCGACGAAGT (reverse);
[0020] Extract DNA from sunflower seeds or diseased plants, and use synthetic primers to carry out PCR amplification. The PCR is carried out using steps known in the art, and then the amplified product is subjected to gel electrophoresis. display, as attached figure 1 As shown, it means that the sunflower seeds or diseased plants are infected with black stem disease, and this method can specifically identify black stem disease. The method can be used to detect sunflower seeds carrying bacteria to control the long-distance spread of t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

