Efficient method for synthesizing cDNA from RNA through reverse transcription

A reverse transcription and high-efficiency technology, applied in the direction of fermentation, can solve problems such as complex reactions, and achieve the effects of increasing the amount of amplification, increasing the amount of synthesis, and simplifying the reverse transcription reaction.

Inactive Publication Date: 2013-02-27
AUTOBIO DIAGNOSTICS CO LTD
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this reaction is more complex and requires a variety of enzymes to participate in the reaction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient method for synthesizing cDNA from RNA through reverse transcription
  • Efficient method for synthesizing cDNA from RNA through reverse transcription
  • Efficient method for synthesizing cDNA from RNA through reverse transcription

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Such as figure 2 As shown, HCV viral RNA is used as the target template RNA for cDNA synthesis, and the reverse transcription compound sequence primer is: 5' ACTGCCTGATAGGG TGCACGGTCTACGAGACCTC, the 3' end of the specific primer has a specific deoxynucleotide sequence (P1) complementary to the template RNA, 19bp, which can be combined with the R1 region of the template RNA. The 5' end of the specific primer has a specific deoxynucleotide sequence (P2) that can be identical to the R2 region of the template RNA sequence, 14bp. exist figure 2 It shows that the R1 and R2 intervals of the RNA template are separated by the S region, and the length of the S region is the length of the P1 sequence plus 1 bp, that is, 20 bp.

[0032] The conventional reverse transcription primer 5' TGCACGGTCTACGAGACCTC was used as a contrast reaction.

[0033] Reverse transcription reaction setup:

[0034] The reverse transcription reaction mix of the reaction configuration includes 1 μg ...

Embodiment 2

[0053] HAV RNA is used as the target template RNA for cDNA synthesis, and the specific reverse transcription compound primers and conventional reverse transcription primers described in the present invention are firstly used to carry out reverse transcription reaction to synthesize target cDNA. Real-time fluorescent PCR technology was used for PCR amplification, and the reverse transcription effects of the two primers were compared. Such as Figure 4 As shown, the reverse transcription compound sequence primer is: RT-1 5' aggaggtttggattctCCatttcaagagtccacaca, the 3' end of the specific primer has a specific deoxynucleotide sequence (P1) complementary to the template RNA, 20bp, which can be combined with the template RNA R1 area. The 5' end of the specific primer has a specific deoxynucleotide sequence (P2) that can be identical to the R2 region of the template RNA sequence, 16bp. exist Figure 4 The figure shows that the R1 and R2 regions of the RNA template are separated b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an efficient method for synthesizing cDNA from RNA through reverse transcription. The cDNA is synthesized with plus stand RNA or mRNA serving as a template by using a reverse transcription primer under the action of a reverse transcriptase, wherein the 3' end of a target area section of the reverse transcription template is sequentially called a specific primer binding domain R1, a spacer domain S and a partial template fragment area R2; the reverse transcription composite sequence primer is combined by two deoxynucleotide segments containing template minus strand sequences and plus strand sequences respectively; and a P1 domain at the 3' end of the reverse transcription primer is a group of specific deoxynucleotide sequences complementary with the template specific primer binding domain R1, and a P2 domain at the 5' end of the reverse transcription primer is a group of specific deoxynucleotide sequences the same with the partial template fragment area R2.

Description

technical field [0001] The invention relates to an RNA reverse transcription reaction, in particular to a method for synthesizing cDNA by efficient RNA reverse transcription using RNA or mRNA as a template. Background technique [0002] In the presence of complementary oligonucleotide primers, various RNA-dependent DNA polymerases can use RNA as a template to synthesize cDNA (Karkas, JD, PROC. NATL ACAD. US 70:3834-3838, 1973), which This reaction is called reverse transcription. Typically, reverse transcriptases are used, such as those from avian myeloblastosis virus (AMV) or Moloney murine leukemia virus (MMLV) (Powell, LM et al., Cell 50:831-840, 1987 ), the synthesis rate of cDNA is relatively low. Use a thermostable (greater than 50°C) DNA-dependent DNA polymerase, (Myers, T. W. and Gelfand, D. H. Biochemistry 30:7661-7666, 1991 and U.S. Pat. Nos. 5,322,770; 5,310,652; and 5,407,800) as reverse transcriptase For cDNA synthesis, the amount of cDNA synthesis can be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/34
Inventor白宪鹤付光宇李桂林高利飞张岚马建军吴学炜苗拥军
OwnerAUTOBIO DIAGNOSTICS CO LTD