Method for synthesizing double-stranded RNA used for inhibiting growth of Chilo suppressalis and using acy1-CoA desaturase SexiVPAE genes

A synthesis method and a technology for the diploid borer, which are applied in the field of agricultural biology, can solve the problems of difficult control of spraying pesticides, and achieve the effects of reducing mechanical damage and facilitating experimental operations.

Inactive Publication Date: 2013-09-18
WUHAN SHANGCHENG BIOTECH
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chilo borer is one of the main pests of rice. When it harms rice, it will drill into the stems of rice, making it difficult to control it by spraying pesticides.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing double-stranded RNA used for inhibiting growth of Chilo suppressalis and using acy1-CoA desaturase SexiVPAE genes
  • Method for synthesizing double-stranded RNA used for inhibiting growth of Chilo suppressalis and using acy1-CoA desaturase SexiVPAE genes
  • Method for synthesizing double-stranded RNA used for inhibiting growth of Chilo suppressalis and using acy1-CoA desaturase SexiVPAE genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1a

[0023] Example 1 Acyl-CoA desaturase SexiVPAE gene fragment acquisition

[0024] The cDNA clone of the acyl-CoAdesaturase SexiVPAE gene was provided by Professor Hua Hongxia from the School of Plant Science and Technology, Huazhong Agricultural University. The sequence of the cDNA clone is shown in SEQ ID NO.1. The sequence fragment of this cDNA clone was used for homology comparison on http: / / www.ncbi.nlm nih gov / , and it was annotated as acyl-CoA desaturase SexiVPAE gene.

[0025](1) According to the sequence of the acyl-CoA desaturase SexiVPAE gene fragment, use Primer Premier3.0 software to design gene-specific upstream and downstream primers, and then add the sequence TAATACGACTCACTATAGG of the T7 promoter to the 5' end of the upstream and downstream primers;

[0026] Upstream primer (P1): GGCACTACGCTTATCCTGTGA (SEQ ID NO.3)

[0027] Downstream primer (P2): CCGCGTTAGTGTCGCTAAAT (SEQ ID NO.4)

[0028] Upstream primer plus T7 promoter (P3): 5'TAATACGACTCACTATAGGGGCACTACG...

Embodiment 2

[0044] Example 2.In vitro transcription of RNA and synthesis and purification of dsRNA

[0045] (1) Using the recovered two PCR products as templates, use T7RiboMAX TM The Express RNAi System Kit (Promega) was used to transcribe RNA in vitro, and the transcription conditions were as follows:

[0046]

[0047] 42°C water bath for 1h. Then the two tubes of transcription products were mixed in equal volumes, placed in a dry bath at 70°C for 10 minutes, and then cooled slowly to room temperature (20 minutes). Add 1 μL of 1:200 diluted RNase Solution and 0.5 μL of RQ1 RNase-Free DNase (T7RiboMAX TM Express RNAi System kit comes with), 37°C for 30min. Add 0.1 volume of 3M NaAC and 1 volume of isopropanol, mix and place on ice for 5 min, and centrifuge at 13000 rpm for 10 min. Discard the supernatant, add 0.5 mL of 75% ethanol, and centrifuge at 13,000 rpm for 5 min. Remove the supernatant, air-dry at room temperature for 15 min, add 200 μL nuclease-free water to dissolve. ...

Embodiment 3

[0059] Embodiment 3.dsRNA feeding experiment

[0060] The configuration of the artificial feed for Chilo suppressalis refers to the formula published by Liu Huimin and Zhang Guoan (2008). Casein 10.00g, yeast powder 18.75g, cellulose 7.50g, sucrose 15.00g, glucose 7.50g, vitamin C 7.50g, multivitamin B 3.00g, cholesterol 0.375g, choline chloride 0.25g, Beck's salt 2.50g , sorbic acid 1.35g, agar 13.49g and tap water 809.25g.

[0061] Weigh the prepared various feed ingredients respectively, put them into a container and mix them evenly. Simultaneously take agar by weighing 10% of the formula total dry matter weight (expressed in G), put into another container that fills 6 times of DEPC H of G, add the sorbic acid of 1% G after heating and melting, stir and make When the temperature drops to 60°C, add Beck's salt solution, choline chloride and cholesterol respectively, and finally add an appropriate amount of purified dsRNA solution to make the final concentration reach 50ng / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for synthesizing double-stranded RNA used for inhibiting the growth of Chilo suppressalis and using acy1-CoA desaturase SexiVPAE genes, which comprises the following steps of: designing a corresponding PCR primer according to the cDNA cloning sequence of acy1-CoA desaturase SexiVPAE genes of Chilo suppressalis; amplifying the cDNA fragments of acy1-CoA desaturase SexiVPAE genes Through a PCR method, and carrying out in-vitro transcription on the obtained object so as to synthesize dsRNA; and adding the dsRNA into a Chilo suppressalis artificial feed, and feeding Chilo suppressalis with the artificial feed containing the dsRNA. Artificial feeding studies show that high-concentration dsRNA can significantly increase the death rate of Chilo suppressalis larvae and inhibit the growth of the larvae, and the results lay the important foundation for effectively controlling bivoltine by further using the dsRNA sequence in production.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and relates to the lethal gene fragment acyl-CoA desaturase SexiVPAE and dsRNA thereof based on RNA interference technology. Background technique [0002] RNA interference (RNA interference, RNAi) is a specific gene silencing mechanism mediated by RNA in organisms, which exists in most eukaryotic organisms from microorganisms to plants and animals. RNAi is of great significance for organisms to regulate gene expression, resist virus invasion, and maintain their own genome stability. The mechanism of RNAi was discovered in 1998 by Fire et al. Their research shows that exogenous double-stranded RNA (double stranded RNA, dsRNA) can lead to specific silencing of homologous genes in Caenorhabditis elegans, a phenomenon they named RNA interference (RNAi). In fact, people have discovered the phenomenon of RNAi many times before 1998. If Napoli et al. (1990) found the co-suppression (co-suppre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/10A01N57/16A01P7/04
Inventor陈建军邵琴王林胡攀
OwnerWUHAN SHANGCHENG BIOTECH