Tomato zonate spot virus RT-LAMP detection method, primer group and application of tomato zonate spot virus RT-LAMP detection method

A technology of RT-LAMP and detection primers is applied in the field of tomato ring spot virus detection, which can solve the problems of expensive instruments, tomato production loss, time-consuming and other problems, and achieves the effect of reducing losses and simplifying disease diagnosis and treatment.

Inactive Publication Date: 2013-12-11
INST OF PLANT PROTECTION GUANGXI ACADEMY OF AGRI SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2012, in Luxi County, Honghe Prefecture, Yunnan Province, 5333.3hm2 of tomato crops were destroyed due to TZSV infection, which caused great losses to the local tomato production.
[0003] At present, the detection methods for tomato ring spot virus mainly include electron microscopy, molecular biology methods, and serological methods, all of which require expensive instruments (PCR, electron microscope, etc.) and are time-consuming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tomato zonate spot virus RT-LAMP detection method, primer group and application of tomato zonate spot virus RT-LAMP detection method
  • Tomato zonate spot virus RT-LAMP detection method, primer group and application of tomato zonate spot virus RT-LAMP detection method
  • Tomato zonate spot virus RT-LAMP detection method, primer group and application of tomato zonate spot virus RT-LAMP detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Tomato Ring Spot Virus RT-LAMP Primer Design

[0021] According to the gene sequence (EF552435, NC020026) of the L segment of tomato ring spot virus reported on NCBI, combined with the sequencing results of tomato ring spot virus, using VECTOR NTI alignX for comparison and analysis, the conserved region of the gene sequence 5080-6000nt was selected , use the online primer design software Primer Explorer V4 to design primers, and finally select the following RT-LAMP detection primer set:

[0022] Outer primer pair F3 and B3,

[0023] Upstream primer F3: CTCGGTTATTTTGTTAAACTCTTTG (see SEQ.ID.No.1 in the sequence listing),

[0024] Downstream primer B3: TGAAATGGAGAATTTAGAAGTAGAC (see SEQ.ID.No.2 in the sequence listing).

[0025] inner primer pair FIP and BIP,

[0026] Upstream primer FIP: ACCTTCATGAAAATCAGGTATGGAA-TTCACTGACTTTCTTAGATTTAAGC (see SEQ.ID.No.3 in the sequence listing),

[0027] Downstream primer BIP: CAACTGTTAAAGGGTGGCTGTTA-CTTGATGATGTCCGGAGAC (...

Embodiment 2

[0028] Example 2 Establishment of Tomato Ring Spot Virus RT-LAMP Reaction System

[0029] By setting the ratio of outer (B3 / F3) and inner (BIP / FIP) primers with different final concentrations, the optimal combination was determined to be 0.25 μM:1 μM; temperature (60°C, 61°C, 62°C, 63°C, 64°C, 65°C, see results figure 1 ), reaction time (30min, 40min, 60min, 80min, 100min, 120min, see the results Figure 5 ), optimize and obtain the best reaction parameters, and establish a detection system for tomato ring spot virus. The optimized reaction system (25 μl) is shown in Table 1.

[0030] Table 1 optimized tomato ring spot virus RT-LAMP reaction system

[0031]

[0032]

[0033] Mix the reactants according to the composition in Table 1, react at a constant temperature at 63° C. for 1 hour, and react at 80° C. for 10 minutes to terminate the RT-LAMP reaction. Take 2 μl of the amplification product and run it on 1.2% agarose gel (adding 1.2‰ gel-red fluorescent dye) in 0.5...

Embodiment 3

[0035] Example 3 RT-PCR and RT-LAMP sensitivity experiment

[0036] In order to determine the sensitivity of RT-PCR and RT-LAMP in detecting tomato ring spot virus, the extracted tobacco total RNA was measured by a spectrophotometer (NanoDrop1000 (Thermo Scientific, USA)) at a concentration of 1665 ng / μl. RNAase Free water was used for 10-fold dilution, and 2 μl of the RNA multiple dilution was used as a template for RT-LAMP reaction, and the reaction was carried out with reference to the reaction system in Example 2. After the reaction is completed, take 2 μl of the amplified product and run it on 1.2% agarose gel (adding 1.2‰ of gel-red fluorescent dye) for 30-40 min in 0.5x TAE electrophoresis buffer and 120V voltage. Placed under the fluorescence imaging system for observation (results see figure 2 ). At the same time, use the multiple dilution of the total RNA in the RT-LAMP reaction as the template for RT-PCR, and use the B3 / F3 primer as the reaction primer for RT-PCR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a tomato zonate spot virus RT-LAMP detection method, a primer group and application of the tomato zonate spot virus RT-LAMP detection method. The inventor adopts the LAMP (Loop-Mediated Isothermal Amplification) technology and designs the corresponding RT-LAMP detection primer group according to the gene sequence of an L-fragment of the tomato zonate spot virus, the primer group comprises an outside primer pair F3 and B3 and an inside primer pair FIP and BIP, and accordingly the RT-LAMP detection method for detecting the tomato zonate spot virus and a kit are invented. When the detection method and the kit are used, whether tomato zonate spot virus infection exists or not can be rapidly detected only by extracting total RNA of a suspected infected plant sample like tobacco, hot pepper, tomato and weeds and conducting the LAMP, so that the basic level can conveniently, rapidly, accurately and easily identify the virus so as to take proper prevention measures and reduce the loss brought by the disease.

Description

technical field [0001] The invention belongs to the technical field of detection of tomato ring spot virus, and in particular relates to a detection method of tomato ring spot virus RT-LAMP, a primer set and an application thereof. Background technique [0002] Tomato zonate spot virus (TZSV) belongs to the Tospovirus genus of the Bunyaviridae family and is a new species of Tospovirus first reported in China in 2008. It can also be transmitted by Thrips tabaci and Thrips western flower. Under natural conditions, TZSV can infect 24 crops and weeds such as tomato, pepper, potato and tobacco. TZSV can infect and damage tomato and tobacco throughout the growth and development period, and the younger the seedling age, the higher the ambient temperature, the more severe the disease. A survey in Jingxi County, Guangxi in 2009 showed that the tobacco area with a TZSV incidence rate of more than 10% was about 2,000 mu, and the incidence rate in serious plots was as high as 41%. Man...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 李战彪秦碧霞蔡健和徐鹏超韦学平周文亮林北森
Owner INST OF PLANT PROTECTION GUANGXI ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap