Tomato zonate spot virus RT-LAMP detection method, primer group and application of tomato zonate spot virus RT-LAMP detection method
A technology of RT-LAMP and detection primers is applied in the field of tomato ring spot virus detection, which can solve the problems of expensive instruments, tomato production loss, time-consuming and other problems, and achieves the effect of reducing losses and simplifying disease diagnosis and treatment.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Tomato Ring Spot Virus RT-LAMP Primer Design
[0021] According to the gene sequence (EF552435, NC020026) of the L segment of tomato ring spot virus reported on NCBI, combined with the sequencing results of tomato ring spot virus, using VECTOR NTI alignX for comparison and analysis, the conserved region of the gene sequence 5080-6000nt was selected , use the online primer design software Primer Explorer V4 to design primers, and finally select the following RT-LAMP detection primer set:
[0022] Outer primer pair F3 and B3,
[0023] Upstream primer F3: CTCGGTTATTTTGTTAAACTCTTTG (see SEQ.ID.No.1 in the sequence listing),
[0024] Downstream primer B3: TGAAATGGAGAATTTAGAAGTAGAC (see SEQ.ID.No.2 in the sequence listing).
[0025] inner primer pair FIP and BIP,
[0026] Upstream primer FIP: ACCTTCATGAAAATCAGGTATGGAA-TTCACTGACTTTCTTAGATTTAAGC (see SEQ.ID.No.3 in the sequence listing),
[0027] Downstream primer BIP: CAACTGTTAAAGGGTGGCTGTTA-CTTGATGATGTCCGGAGAC (...
Embodiment 2
[0028] Example 2 Establishment of Tomato Ring Spot Virus RT-LAMP Reaction System
[0029] By setting the ratio of outer (B3 / F3) and inner (BIP / FIP) primers with different final concentrations, the optimal combination was determined to be 0.25 μM:1 μM; temperature (60°C, 61°C, 62°C, 63°C, 64°C, 65°C, see results figure 1 ), reaction time (30min, 40min, 60min, 80min, 100min, 120min, see the results Figure 5 ), optimize and obtain the best reaction parameters, and establish a detection system for tomato ring spot virus. The optimized reaction system (25 μl) is shown in Table 1.
[0030] Table 1 optimized tomato ring spot virus RT-LAMP reaction system
[0031]
[0032]
[0033] Mix the reactants according to the composition in Table 1, react at a constant temperature at 63° C. for 1 hour, and react at 80° C. for 10 minutes to terminate the RT-LAMP reaction. Take 2 μl of the amplification product and run it on 1.2% agarose gel (adding 1.2‰ gel-red fluorescent dye) in 0.5...
Embodiment 3
[0035] Example 3 RT-PCR and RT-LAMP sensitivity experiment
[0036] In order to determine the sensitivity of RT-PCR and RT-LAMP in detecting tomato ring spot virus, the extracted tobacco total RNA was measured by a spectrophotometer (NanoDrop1000 (Thermo Scientific, USA)) at a concentration of 1665 ng / μl. RNAase Free water was used for 10-fold dilution, and 2 μl of the RNA multiple dilution was used as a template for RT-LAMP reaction, and the reaction was carried out with reference to the reaction system in Example 2. After the reaction is completed, take 2 μl of the amplified product and run it on 1.2% agarose gel (adding 1.2‰ of gel-red fluorescent dye) for 30-40 min in 0.5x TAE electrophoresis buffer and 120V voltage. Placed under the fluorescence imaging system for observation (results see figure 2 ). At the same time, use the multiple dilution of the total RNA in the RT-LAMP reaction as the template for RT-PCR, and use the B3 / F3 primer as the reaction primer for RT-PCR...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com