Unlock instant, AI-driven research and patent intelligence for your innovation.

Shellfish sn RNA U6 gene, primer, and applications thereof

A gene and shellfish technology, applied in the field of shellfish microRNA expression analysis, the complete sequence of shellfish snRNA U6 gene and its primers, can solve the problems of designing primers, lack of U6 gene, etc., achieving low cost, simple operation and sensitivity high effect

Active Publication Date: 2014-11-05
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current U6 gene sequence in shellfish has not been cloned, and there is no primer designed based on the shellfish U6 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Shellfish sn RNA U6 gene, primer, and applications thereof
  • Shellfish sn RNA U6 gene, primer, and applications thereof
  • Shellfish sn RNA U6 gene, primer, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The putative Oyster U6 gene sequence was obtained from the Oyster oyster genome based on homologous sequence searches. Primers were designed in its conserved region to obtain the partial sequence of the U6 gene. According to the obtained partial sequence, the full length of the U6 gene was obtained by using RACE technology.

[0033] Sequence Listing (1) Information of SEQ ID NO 1

[0034] sequence feature

[0035] Length: 109nt

[0036] Type: nucleic acid

[0037] Chain type: double chain

[0038] Topology: Linear

[0039] Molecule type: DNA

[0040] Feature name: snRNA (1-109)

[0041] Source: Long Oyster

[0042] Sequence description:

[0043] GTACTTGCTTTTCGGCAGTACATATATTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTTT

[0044] Based on homology alignments with other species (see figure 1 ), and found that the gene sequence was highly conserved among different species, thus confirming it as U6 gene.

Embodiment 2

[0046] A pair of primers were designed according to the U6 gene sequence. The pair of primers has high specificity, the amplification efficiency is 1.0016, and the applicable annealing temperature range is wide (54-68°C).

[0047] Design a pair of fluorescent quantitative primers in the Primer Premier 5 software based on the full length of the U6 gene:

[0048] Forward primer: 5'-CGGCAGTACATATATTAAAATTGGAACGA-3'

[0049] Reverse primer: 5'-TGGAACGCTTCACGAATTTGCGTGTCATC-3'

[0050] This primer amplifies a 90bp PCR product:

[0051]CGGCAGTACATATATTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCA

[0052] The specific embodiment of this pair of primer PCR amplification is as follows:

[0053] 1. Experimental materials: Oyster larvae and adult tissue gills were taken from Qingdao, Shandong. Larval samples were from F2 offspring, and F1 was 51 female and 1 male oyster from the G3 line. The G3 family was constructed from a pair of male and female oyst...

Embodiment 3

[0080] U6 was used as an internal reference, and the method based on SYBR Green dye fluorescence quantitative PCR was used. See the literature: [Shi R, Chiang VL (2005) Facile means for quantifying microRNA expression by real-time PCR. Biotechniques 2550 39: 519-525.] for long Oyster miRNA relative quantification.

[0081] The miRNA sequence (see Table 2) and sequencing expression profile (see Table 3) of Oyster oyster are from the data of our laboratory, by the method of deep sequencing, see the literature [Huang J, Hao P, Chen H, Hu W, Yan Q, et a1. (2009) Genome-wide identification of Schistosoma japonicum microRNAs using a deep-sequencing approach. P1os One 4: e8206,] obtained:

[0082] The experimental materials and RNA extraction method are the same as in Example 2. Small RNA sequencing was performed on the I1lumina sequencing platform of Shenzhen BGI Institute. Firstly, 18-30 nt RNAs were recovered from the sample RNA by gel cutting, and the 5’ and 3’ sequencing adapt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of molecular biology, and especially relates to applications of a complete sequence of shellfish sn RNA U6 gene, and a primer thereof on expression analysis of shellfish micro RNA. The invention discloses a reference gene and a primer thereof in mi RNA relative quantification expression analysis based on the fluorescence quantification PCR. We obtain the complete sequence of crassostrea gigas U6 gene by cloning, whose homologous gene human sn RNA U6 has a constant expression and can be used as an expression analysis reference of mi RNA. The obtained expression result by taking the human sn RNA U6 as the reference is highly identical to the sequencing expression profile, and thus it is proved that the U6 gene is suitable for being taken as a reference of mi RNA expression analysis.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to the application of the full sequence of a shellfish snRNA U6 gene and its primers to the expression analysis of shellfish microRNA. Background technique [0002] Shellfish, belonging to the clambranch (or bivalves) in the mollusk phylum, common species include oysters, mussels, clams, and razor clams. There are about 10,000 species in existence, 80% of which live in the ocean. Most species of shellfish are edible. Many shellfish are tender, delicious, nutritious and have high economic value. They are important aquaculture objects in the world. [0003] MicroRNA (miRNA) is a kind of small molecule non-coding single-stranded RNA that widely exists in the biological world. It is about 21-24nt long. It is widely expressed in various developmental stages and different tissues and organs, and participates in various physiological activities of organisms. Because of its importance in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/11C12Q1/68G01N21/64
Inventor 黄雯阙华勇许飞李莉张国范
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI