DNA (Deoxyribonucleic Acid) sequence of meiiones unguiculataus

A long-clawed gerbil, sequence technology, applied in the direction of recombinant DNA technology, DNA / RNA fragments, biochemical equipment and methods, etc., can solve the problem of less research on molecular identification of rodents, and achieve the effect of ensuring accuracy and reliability

Inactive Publication Date: 2014-04-02
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Mitochondrial COI gene is the most widely used molecular marker in rodent identification research. At present, there are few researches on rodent molecular identification in China. This invention intends to provide a scientific basis for rapid identification of long-clawed gerbils

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA (Deoxyribonucleic Acid) sequence of meiiones unguiculataus
  • DNA (Deoxyribonucleic Acid) sequence of meiiones unguiculataus
  • DNA (Deoxyribonucleic Acid) sequence of meiiones unguiculataus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1. Collection and preservation of specimens

[0035] The specimens were collected by the mouse trap method, and the collected specimens were directly dissected after alcohol disinfection, and the livers were preserved in 75% alcohol and brought back.

[0036] 2. DNA template preparation

[0037] The gerbil DNA was extracted using TIANGEN DP304-03 kit, and the extracted DNA samples were stored at -80°C for future use.

[0038] 3. Primer synthesis

[0039] The primers used in this example are as follows:

[0040] Forward primer 5'ACTTCTGGGTGTCCAAAGAATCA3'

[0041] Reverse primer 5'CCTACTCRGCCATTTTACCTATG3'

[0042] 4. PCR amplification

[0043] The PCR reaction system of this embodiment is shown in Table 1.

[0044] Table 1 PCR reaction system of COⅠ gene of long-clawed gerbil (50μL system)

[0045] Element

Volume (μL)

template

3-4

forward primer

2

reverse primer

2

Premix

25

wxya 2 o

17-18

...

Embodiment 2

[0055] The morphological characteristics of the long-clawed gerbil are as follows: 1 pair of upper incisors; the angular process of the mandible is on the same vertical plane as the alveolar of the lower incisors, and is located below the alveolar, the anterior opening of the frame is small, and the coronoid process is obvious; , some species are larger, the tail section is round or flat, covered with hairs or small scales, 3 / 3 of each side of the cheek teeth; The tail generally forms hair bundles; the outline of the skull is not triangular, and the ears are longer, the length of which is 1 / 2 of the length of the hind feet (including claws); Large, with an average of more than 30% of the length of the occipital nose; the sole of the hind foot near the rear ankle has no exposed area, the length of the adult occipital nose is less than 36mm, the tip of the abdomen is white, the base of the hair is gray, the upper and lower sides of the tail are brownish yellow, and the claws are ...

Embodiment 3

[0057] Using the identification method in combination of Example 1 and Example 2, the voles were identified, and the gerbils were quickly identified.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a DNA (Deoxyribonucleic Acid) sequence of meiiones unguiculataus. According to the DNA sequence, in order to provide a method for rapidly identifying meiiones unguiculataus, the species of meiiones unguiculataus is identified by a morphological characteristic identification method, and a COI gene sequence of the species is obtained. The invention further provides a DNA standard gene, primers thereof and a kit thereof for detecting meiiones unguiculataus. According to the DNA sequence, meiiones unguiculataus is identified by the combination of the traditional morphological identification and molecular classification methods, so that the accuracy and reliability of species identification can be ensured.

Description

technical field [0001] The invention relates to the molecular identification of the species of the long-clawed gerbil, in particular to the DNA sequence of the long-clawed gerbil. Background technique [0002] The long-clawed gerbil (Meiiones Unguiculataus) belongs to the hamster family (Cricetidae), the gerbil subfamily, and the genus Meriones. It is also known as yellow mouse or river mouse. It is a small grassland animal and one of the main hosts of plague in my country. At present, long-clawed gerbils are found in Jilin, Hebei, Inner Mongolia, Heilongjiang, Liaoning, Shaanxi, Ningxia, Gansu, Qinghai, and Xinjiang. Both are distributed; also distributed in Mongolia and Russia. The plague foci of long-clawed gerbils is Inner Mongolia. The gerbil has unique anatomical, physiological and behavioral characteristics, making it an animal with important development value. It is a good object for studying human brain blood vessels and studying various filarial, protozoan, nemato...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/53C12N15/11
CPCC12Q1/6888
Inventor 张晓龙王海玲乔舜魏怀波田丽邓华刘润吉
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap