Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Deoxyribonucleic acid (DNA) sequence of narrow-headed vole

A technology of voles and narrow skulls, which is applied in the field of molecular identification of narrow skull vole species, can solve the problem of less research on molecular identification of mice, and achieve the effect of ensuring accuracy and reliability.

Inactive Publication Date: 2014-04-02
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Mitochondrial COI gene is the most widely used molecular marker in rodent identification research. At present, there are few researches on rodent molecular identification in China. This invention intends to provide a method for rapid identification of stenotic cranial voles

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Deoxyribonucleic acid (DNA) sequence of narrow-headed vole
  • Deoxyribonucleic acid (DNA) sequence of narrow-headed vole
  • Deoxyribonucleic acid (DNA) sequence of narrow-headed vole

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] 1. Collection and preservation of specimens

[0034] The specimens were collected by the mouse trap method, and the collected specimens were directly dissected after alcohol disinfection, and the livers were preserved in 75% alcohol and brought back.

[0035] 2. DNA template preparation

[0036] The voles DNA was extracted using TIANGEN DP304-03 kit, and the extracted DNA samples were stored at -80°C for future use.

[0037] 3. Primer synthesis

[0038] The primers used in this example are as follows:

[0039] Forward primer 5'ACTTCTGGGTGTCCAAAGAATCA3'

[0040] Reverse primer 5'CCTACTCRGCCATTTTACCTATG3'

[0041] 4. PCR amplification

[0042] The PCR reaction system of this embodiment is shown in Table 1.

[0043] Table 1 PCR reaction system of COI gene of stenotic voles (50μL system)

[0044] Element

Volume (μL)

template

3-4

forward primer

2

reverse primer

2

Premix

25

wxya 2 o

17-18

...

Embodiment 2

[0054] The morphological identification features of Stenozenius vole are as follows: 1 pair of upper incisors; the corner of the mandible is on the same vertical plane as the alveolar of the lower incisors, and is located below the alveolar, the anterior opening of the frame is small, and the coronoid process is obvious; Individual species are larger, the tail section is round or flat, covered with hairs or small scales, 3 / 3 of each side of the cheek teeth; Hair bundles formed; molar chewing surfaces alternate in triangular arrangement; concha normal, upper incisors almost vertical without protruding forward out of oral cavity; third molar does not have 4 transverse lobes but contains 1 anterior transverse lobe and 2 Or more alternately arranged triangular, small body, adult body length is usually less than 150mm, tail length less than 100mm, hind legs less than 27mm, skull length generally less than 33mm, no gonads on both sides of the back of the body; middle of the posterior...

Embodiment 3

[0056] Using the identification method in combination of Example 1 and Example 2, the voles were identified, and the voles were quickly identified.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a deoxyribonucleic acid (DNA) sequence of a narrow-headed vole. The invention aims to provide a method for quickly identifying the narrow-headed vole, wherein the rat species are identified by a morphological characteristic identification method, and COI gene sequences are obtained. The invention also provides a DNA standard gene, a primer and a kit for detecting the narrow-headed vole. The narrow-headed vole is identified by adopting the traditional morphological identification combined with a molecular classification method, so that the accuracy and the reliability of species identification can be ensured.

Description

technical field [0001] The present invention relates to the molecular identification of species of voles, in particular to the DNA sequence of voles. Background technique [0002] The narrow-headed vole (Microtus gregalis) belongs to the family Cricetidae and belongs to the genus Microtus. Most voles are small rodents, inhabiting grassland areas and living in groups; abroad they are distributed in Russia and Mongolia; domestically they are distributed in Xinjiang, Inner Mongolia, Hebei, Shanxi and other places. When the number of voles is large, it can harm the grassland and reduce the yield of the grassland. Stenotic-headed voles can transmit diseases such as plague, Tularensis disease and tick typhus. [0003] For a long time, the identification of rodents mainly relied on morphological characteristics, but in recent years, with the advancement of DNA sequencing and other technologies, people have successively used molecular biology methods to study the DNA of rodents in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/12C12N15/11
CPCC12Q1/6888
Inventor 张晓龙姚李四慈颖乔舜王海玲房健慧田丽魏怀波
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com