Deoxyribonucleic acid (DNA) sequence of narrow-headed vole
A technology of voles and narrow skulls, which is applied in the field of molecular identification of narrow skull vole species, can solve the problem of less research on molecular identification of mice, and achieve the effect of ensuring accuracy and reliability.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] 1. Collection and preservation of specimens
[0034] The specimens were collected by the mouse trap method, and the collected specimens were directly dissected after alcohol disinfection, and the livers were preserved in 75% alcohol and brought back.
[0035] 2. DNA template preparation
[0036] The voles DNA was extracted using TIANGEN DP304-03 kit, and the extracted DNA samples were stored at -80°C for future use.
[0037] 3. Primer synthesis
[0038] The primers used in this example are as follows:
[0039] Forward primer 5'ACTTCTGGGTGTCCAAAGAATCA3'
[0040] Reverse primer 5'CCTACTCRGCCATTTTACCTATG3'
[0041] 4. PCR amplification
[0042] The PCR reaction system of this embodiment is shown in Table 1.
[0043] Table 1 PCR reaction system of COI gene of stenotic voles (50μL system)
[0044] Element
Volume (μL)
template
3-4
2
2
Premix
25
wxya 2 o
17-18
...
Embodiment 2
[0054] The morphological identification features of Stenozenius vole are as follows: 1 pair of upper incisors; the corner of the mandible is on the same vertical plane as the alveolar of the lower incisors, and is located below the alveolar, the anterior opening of the frame is small, and the coronoid process is obvious; Individual species are larger, the tail section is round or flat, covered with hairs or small scales, 3 / 3 of each side of the cheek teeth; Hair bundles formed; molar chewing surfaces alternate in triangular arrangement; concha normal, upper incisors almost vertical without protruding forward out of oral cavity; third molar does not have 4 transverse lobes but contains 1 anterior transverse lobe and 2 Or more alternately arranged triangular, small body, adult body length is usually less than 150mm, tail length less than 100mm, hind legs less than 27mm, skull length generally less than 33mm, no gonads on both sides of the back of the body; middle of the posterior...
Embodiment 3
[0056] Using the identification method in combination of Example 1 and Example 2, the voles were identified, and the voles were quickly identified.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap