Unlock instant, AI-driven research and patent intelligence for your innovation.

Lamp detection primer set, kit and detection method for cry2ab gene in transgenic crops

A detection kit and detection primer technology, applied in the field of molecular biology, can solve the problems such as no detection method and kit for cry2Ab gene in genetically modified crops, and achieve the effects of simple operation, high sensitivity and strong specificity

Inactive Publication Date: 2015-08-12
JILIN ACAD OF AGRI SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no detection method and kit for detecting the cry2Ab gene in transgenic crops using the LAMP method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lamp detection primer set, kit and detection method for cry2ab gene in transgenic crops
  • Lamp detection primer set, kit and detection method for cry2ab gene in transgenic crops
  • Lamp detection primer set, kit and detection method for cry2ab gene in transgenic crops

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 A kit without a chromogenic agent and a detection method thereof.

[0044] Prepare the LAMP detection kit of cry2Ab gene according to the following formula:

[0045] (1) Primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, inner primer 2, loop primer 1, and loop primer 2, and prepare the dry powder of primers with sterilized deionized water to prepare mother solutions with a concentration of 200 μmol / L , then take 5 μL each of outer primer 1 and outer primer 2, 40 μL each of inner primer 1 and inner primer 2, 20 μL each of loop primer 1 and loop primer 2, 70 μL of sterilized deionized water, and mix well to prepare 200 μL cry2Ab gene LAMP detection primer solution, wherein the primer sequences are:

[0046] Outer primer 1: ACTGTTCCTCAACCGCTTG (SEQ ID NO: 1);

[0047] Outer primer 2: GGAGTAGTCCCTGGTGTAGT (SEQ ID NO: 2);

[0048] Internal primer 1: AGGAGAGGTGCAGGTTGGCA-CTCAGTTCCAGATGCAAGGC (SEQ ID NO: 3);

[0049] Internal primer 2: GA...

Embodiment 2

[0064] Example 2 The kit containing the chromogenic agent and its detection method.

[0065] Prepare the LAMP detection kit of cry2Ab gene according to the following formula:

[0066] (1) Primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, inner primer 2, loop primer 1, and loop primer 2, and prepare the dry powder of primers with sterilized deionized water to prepare mother solutions with a concentration of 200 μmol / L , then take 5 μL each of outer primer 1 and outer primer 2, 40 μL each of inner primer 1 and inner primer 2, 20 μL each of loop primer 1 and loop primer 2, 70 μL of sterilized deionized water, and mix well to prepare 200 μL cry2Ab gene LAMP detection primer solution, wherein the primer sequences are:

[0067] Outer primer 1: ACTGTTCCTCAACCGCTTG (SEQ ID NO: 1);

[0068] Outer primer 2: GGAGTAGTCCCTGGTGTAGT (SEQ ID NO: 2);

[0069] Internal primer 1: AGGAGAGGTGCAGGTTGGCA-CTCAGTTCCAGATGCAAGGC (SEQ ID NO: 3);

[0070] Internal primer 2: G...

Embodiment 3

[0086] Embodiment 3 The specificity experiment of kit and detection method.

[0087]Experiments were carried out on the specificity of the kit described in Example 1 and its detection method, and the test samples included: cry1A.105 and cry2Ab gene-transformed corn MON89034, cry1Ab-gene-transformed corn MON810, Bt11, Bt176, cry1Ac-gene-transformed cotton MON531, cry1Ac and cry2Ab cotton MON15985, cry1Ab rice KF-6, cry1Ab / Ac rice TT51-1, cry3Bb maize MON863, MON88017, cry3A maize MIR604, cry1F maize TC1507, cry34Ab and cry35Ab maize 59122 13 kinds of insect-resistant genetically modified crops, as well as non-genetically modified crops.

[0088] In this example, only the LAMP amplification products of transgenic maize MON89034 and transgenic cotton MON15985 containing cry2Ab gene showed typical amplification curves, while other transgenic crops showed typical amplification curves, indicating that the kit and detection method of the present invention The method has good specifi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP detection primer group of a cry2Ab gene in a transgenic crop and a detection kit as well as a detection method. The LAMP detection primer group comprises six specific primers, and the nucleotide sequences of the specific primers are as shown in SEQ ID NO: 1-6. The detection kit comprises a primer solution, DNA (deoxyribonucleic acid) polymerase with strand displacement activity, 10* reaction buffer liquid, dNTPs solution, positive DNA control and negative DNA control and can aslo contain a color developing agent. The detection method is characterized in that methods of using the specific primers and the DNA polymerase with the strand displacement activity for amplifying a sample DNA template at the temperature of 63-65 DEG C, adding the color developing agent to observe change in color or directly observe change in turbidity of precipitants in a reaction tube and the like are used for judging whether a sample contains the cry2Ab gene. The method does not need special instruments and has the characteristics of fastness, high efficiency, simplicity and convenience to operate, strong specificity, high sensitivity and the like and is suitable for field test.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a detection method for transgenic plants and products thereof, in particular to a primer set, a kit and a detection method for rapidly detecting the cry2Ab gene in transgenic crops using loop-mediated isothermal amplification technology (LAMP) . Background technique [0002] According to the statistics of the International Service for the Application of Agricultural Biotechnology (ISAAA), in 2012, the planting area of ​​transgenic crops in the world reached 170.3 million hectares, an increase of 100 times compared with 1996. This growth rate makes transgenic technology the most rapidly applied crop technology in the history of modern agriculture. . The types of genetically modified crops currently planted mainly include soybean, corn, cotton, rape, tomato, papaya, sugar beet, alfalfa, etc., and the target traits are mainly insect resistance, herbicide resistance or compo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q2531/119
Inventor 李飞武闫伟龙丽坤李葱葱张明邢珍娟董立明
Owner JILIN ACAD OF AGRI SCI