Lamp detection primer set, kit and detection method for cry2ab gene in transgenic crops
A detection kit and detection primer technology, applied in the field of molecular biology, can solve the problems such as no detection method and kit for cry2Ab gene in genetically modified crops, and achieve the effects of simple operation, high sensitivity and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 A kit without a chromogenic agent and a detection method thereof.
[0044] Prepare the LAMP detection kit of cry2Ab gene according to the following formula:
[0045] (1) Primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, inner primer 2, loop primer 1, and loop primer 2, and prepare the dry powder of primers with sterilized deionized water to prepare mother solutions with a concentration of 200 μmol / L , then take 5 μL each of outer primer 1 and outer primer 2, 40 μL each of inner primer 1 and inner primer 2, 20 μL each of loop primer 1 and loop primer 2, 70 μL of sterilized deionized water, and mix well to prepare 200 μL cry2Ab gene LAMP detection primer solution, wherein the primer sequences are:
[0046] Outer primer 1: ACTGTTCCTCAACCGCTTG (SEQ ID NO: 1);
[0047] Outer primer 2: GGAGTAGTCCCTGGTGTAGT (SEQ ID NO: 2);
[0048] Internal primer 1: AGGAGAGGTGCAGGTTGGCA-CTCAGTTCCAGATGCAAGGC (SEQ ID NO: 3);
[0049] Internal primer 2: GA...
Embodiment 2
[0064] Example 2 The kit containing the chromogenic agent and its detection method.
[0065] Prepare the LAMP detection kit of cry2Ab gene according to the following formula:
[0066] (1) Primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, inner primer 2, loop primer 1, and loop primer 2, and prepare the dry powder of primers with sterilized deionized water to prepare mother solutions with a concentration of 200 μmol / L , then take 5 μL each of outer primer 1 and outer primer 2, 40 μL each of inner primer 1 and inner primer 2, 20 μL each of loop primer 1 and loop primer 2, 70 μL of sterilized deionized water, and mix well to prepare 200 μL cry2Ab gene LAMP detection primer solution, wherein the primer sequences are:
[0067] Outer primer 1: ACTGTTCCTCAACCGCTTG (SEQ ID NO: 1);
[0068] Outer primer 2: GGAGTAGTCCCTGGTGTAGT (SEQ ID NO: 2);
[0069] Internal primer 1: AGGAGAGGTGCAGGTTGGCA-CTCAGTTCCAGATGCAAGGC (SEQ ID NO: 3);
[0070] Internal primer 2: G...
Embodiment 3
[0086] Embodiment 3 The specificity experiment of kit and detection method.
[0087]Experiments were carried out on the specificity of the kit described in Example 1 and its detection method, and the test samples included: cry1A.105 and cry2Ab gene-transformed corn MON89034, cry1Ab-gene-transformed corn MON810, Bt11, Bt176, cry1Ac-gene-transformed cotton MON531, cry1Ac and cry2Ab cotton MON15985, cry1Ab rice KF-6, cry1Ab / Ac rice TT51-1, cry3Bb maize MON863, MON88017, cry3A maize MIR604, cry1F maize TC1507, cry34Ab and cry35Ab maize 59122 13 kinds of insect-resistant genetically modified crops, as well as non-genetically modified crops.
[0088] In this example, only the LAMP amplification products of transgenic maize MON89034 and transgenic cotton MON15985 containing cry2Ab gene showed typical amplification curves, while other transgenic crops showed typical amplification curves, indicating that the kit and detection method of the present invention The method has good specifi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 