Primer group and probe group for detecting acute respiratory infectious diseases as well as application method and kit thereof

An application method and technology of the respiratory tract, applied in the field of disease detection, can solve the problems of virus and bacteria application, and achieve the effect of good pairing specificity

Inactive Publication Date: 2014-08-20
FUJIAN PROVINCIAL HOSPITAL +2
View PDF4 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this technology has not been applied in clinical detection of viruses, bacteria, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group and probe group for detecting acute respiratory infectious diseases as well as application method and kit thereof
  • Primer group and probe group for detecting acute respiratory infectious diseases as well as application method and kit thereof
  • Primer group and probe group for detecting acute respiratory infectious diseases as well as application method and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0142] (1) A primer group for detecting acute respiratory infectious diseases, which is composed of any two or more primers among the 14 primers. The construction process of the primers is as follows: the inventor uses Clustal Omega and Vector NTI Suite The 8.0 software compares the DNA sequences of the known specific genes of the pathogens, and screens out the pathogen-specific sequences of acute respiratory infectious diseases. The nucleotide sequences are as follows:

[0143] ①Specific sequence of cytomegalovirus (HCMV for short):

[0144] AAGTTTTGTGCCCCAACGGTACGGGCTGCAGGTAAAGTGCGATCAAGAACGCGATAACGCCGATCACAAACAGCGTGACGATGACCTGCCATCGACGGTGATTATGGCCGGCTAGACCCGTGACGCAGCTGCAGAGGCTAAAAAGCACGC;

[0145] ②Adenovirus (referred to as AD) specific sequence:

[0146] CGCAGTGGTCTTACATGCACATCTCGGGCCAGGACGCCTCGGAGTACCTGAGCCCCGGGCTGGTGCAGTTCGCCCGCGCCACCGAGACGTACTTCAGCCTGAATAACAAGTTTAGAAACCCCACGGTGGCGCCTACGCACGACGTGACCACAGACCGGTCTCAGCGTTTGACGCTGCGGTTCATCCCCGTGGACCGCGAGGATACTGCGTACTCGTACAA...

Embodiment 2

[0334] Embodiment 2 is different from embodiment 1 in that:

[0335] (1) A primer group for detecting acute respiratory infectious diseases, consisting of any one set of primers among 14 kinds of primers, the nucleic acid sequences of the 14 kinds of primers are the same as those in Example 1.

[0336] (2) A probe group used in conjunction with the above primer group, the nucleotide sequence of this probe group is the same as that in Example 1.

[0337] (3) The application method of the primer group and probe group used for acute respiratory infectious disease pathogens of the present invention, in the specific implementation process, the primer group is composed of a set of primers corresponding to SA, and the probe group is also composed of SA A corresponding probe composition, its application steps are:

[0338] (1) Use the primers in the above primer group as amplification primers, and the DNA of the sample to be tested as a DNA template to form a set of PCR amplifica...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a primer group for detecting acute respiratory infectious diseases. Causative agents include 14 types of causative agents of the respiratory infectious diseases, such as human cytomegalovirus and adenovirus. The primer group comprises any one or more than two groups of primers of the 14 types of causative agents. The invention also provides a probe group consisting of probes which are correspondingly paired with the primers in the primer group one by one, as well as an application method for applying the primer group and the probe group to liquid chip rapid detection methods. The application method can be used for detecting one or simultaneously detecting a plurality of causative agents of the acute respiratory infectious diseases, and also is high in sensitivity and good in specificity.

Description

technical field [0001] The invention relates to the field of disease detection, in particular to a primer group, a probe group, an application method and a kit for detecting acute respiratory infectious diseases. Background technique [0002] Once an acute respiratory infectious disease breaks out, it will spread in an extremely rapid manner. Therefore, the key to the prevention and treatment of acute respiratory infectious diseases lies in early diagnosis, early isolation, and early treatment. [0003] The existing detection methods for acute respiratory infectious diseases mainly include: (1) pathogen isolation and culture method: this method is not only cumbersome in operation, low in sensitivity, long in time, but also technically difficult, and it is difficult to carry out in ordinary medical places; (2) Immunoassay: This method is a retrospective method. Patients need to be infected to produce antibodies before they can be detected. It cannot meet the needs of rapid de...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
CPCC12Q1/70C12Q1/6816C12Q2563/149C12Q2537/143C12Q2563/131
Inventor 陈愉生沈晓娜伍严安王毅
Owner FUJIAN PROVINCIAL HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap