Primer group and probe group for detecting acute respiratory infectious diseases as well as application method and kit thereof
An application method and technology of the respiratory tract, applied in the field of disease detection, can solve the problems of virus and bacteria application, and achieve the effect of good pairing specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0142] (1) A primer group for detecting acute respiratory infectious diseases, which is composed of any two or more primers among the 14 primers. The construction process of the primers is as follows: the inventor uses Clustal Omega and Vector NTI Suite The 8.0 software compares the DNA sequences of the known specific genes of the pathogens, and screens out the pathogen-specific sequences of acute respiratory infectious diseases. The nucleotide sequences are as follows:
[0143] ①Specific sequence of cytomegalovirus (HCMV for short):
[0144] AAGTTTTGTGCCCCAACGGTACGGGCTGCAGGTAAAGTGCGATCAAGAACGCGATAACGCCGATCACAAACAGCGTGACGATGACCTGCCATCGACGGTGATTATGGCCGGCTAGACCCGTGACGCAGCTGCAGAGGCTAAAAAGCACGC;
[0145] ②Adenovirus (referred to as AD) specific sequence:
[0146] CGCAGTGGTCTTACATGCACATCTCGGGCCAGGACGCCTCGGAGTACCTGAGCCCCGGGCTGGTGCAGTTCGCCCGCGCCACCGAGACGTACTTCAGCCTGAATAACAAGTTTAGAAACCCCACGGTGGCGCCTACGCACGACGTGACCACAGACCGGTCTCAGCGTTTGACGCTGCGGTTCATCCCCGTGGACCGCGAGGATACTGCGTACTCGTACAA...
Embodiment 2
[0334] Embodiment 2 is different from embodiment 1 in that:
[0335] (1) A primer group for detecting acute respiratory infectious diseases, consisting of any one set of primers among 14 kinds of primers, the nucleic acid sequences of the 14 kinds of primers are the same as those in Example 1.
[0336] (2) A probe group used in conjunction with the above primer group, the nucleotide sequence of this probe group is the same as that in Example 1.
[0337] (3) The application method of the primer group and probe group used for acute respiratory infectious disease pathogens of the present invention, in the specific implementation process, the primer group is composed of a set of primers corresponding to SA, and the probe group is also composed of SA A corresponding probe composition, its application steps are:
[0338] (1) Use the primers in the above primer group as amplification primers, and the DNA of the sample to be tested as a DNA template to form a set of PCR amplifica...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com