A SNP marker related to sexual precocity in mitten crab sinensis and its application

A Chinese mitten crab, precocious technology, applied in the direction of recombinant DNA technology, DNA/RNA fragments, etc., can solve the problems of unclear exact mechanism, complicated occurrence mechanism, waste of bait and so on

Active Publication Date: 2016-06-08
FRESHWATER FISHERIES RES INSITUTE OF JIANGSUPROVINCE
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existence of a large number of precocious first-year-old crabs not only causes a huge waste of bait, but also because their appearance is similar to large-scale crab species, if precocious individuals are accidentally used for subsequent commercial crab breeding when selecting crab species, it will bring great harm to production. come a huge loss
According to current research, the mechanism of precocious puberty in river crab is very complex, which may be related to internal genetic factors and various external environmental factors, but the exact mechanism of its formation is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A SNP marker related to sexual precocity in mitten crab sinensis and its application
  • A SNP marker related to sexual precocity in mitten crab sinensis and its application
  • A SNP marker related to sexual precocity in mitten crab sinensis and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] (1) Detection method: Genomic DNA of different river crab individuals was extracted by conventional phenol-chloroform method, and genotyped by PCR-based restriction fragment length polymorphism (PCR‐RFLP);

[0024] PCR reaction conditions:

[0025] The length of the PCR product is 359bp, and the PCR amplification primers are: F: CGTTCACCTCGTTTACCCCAC (SEQ ID NO.1); R: CCCTCAAACAGCTTTAGAGTT (SEQ ID NO.2). The PCR reaction system is 20 μL, including: 10×PCRBuffer 2.5 μL, Mg 2+ (2.5mmol / L) 2.5μL, dNTP (2.5mmol / L) 1.7μL, forward and reverse primers 0.75μL (10nmol / L), Taq enzyme 0.2U, DNA template 1μL (50ng / μL), deionized double distilled Water to make up volume. A total of 30 cycles of PCR reaction were performed, with pre-denaturation at 95°C for 5 min before the cycle, each cycle including denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 60 s, and extension at 72°C for 5 min after the cycle. The amplified product was electrophoresed on a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a SNP marker related to the sexual precocity trait of Chinese mitten crab and its application. The SNP is located in the 3'‐UTR region of the molting inhibitory hormone gene MIH (AY310313.1), the specific position is 3088 bp, and the base variation information is SNP A3088T T>G. The results of trait-genotype correlation analysis showed that there was a significant correlation between the SNP variation and the sexual precocious puberty traits of river crabs, and the risk of sexual precocious puberty traits in GG genotype crabs was 2.175 times higher than that in TT genotype individuals . The polymorphic SNP marker of the gene related to the precocious puberty of the crab can be used for subsequent genetic breeding research related to the precocious puberty trait of the crab.

Description

technical field [0001] The invention belongs to the technical field of molecular biology detection, and relates to a SNP marker related to the precocious trait of Chinese mitten crab and its application. Background technique [0002] Chinese mitten crab (Eriocheirsinensis), also known as river crab, is an important economic crustacean in my country. For a long time, the precocious puberty problem of first-year-old crab species has generally existed in the process of river crab culture. During the breeding process, the gonads of precocious young crabs mature in the same year. These precocious crab species cannot moult smoothly, and their weight gain is slow or even stagnant. Most of them will die during April to May of the next year, and they cannot continue to be raised to 2-year-old adult crabs. Specification. The existence of a large number of precocious first-year-old crabs not only causes a huge waste of bait, but also because their appearance is similar to large-scale...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 许志强李跃华赵沐子丁淑燕潘建林
Owner FRESHWATER FISHERIES RES INSITUTE OF JIANGSUPROVINCE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap