New application of protein derived from clover and its coding genes

A protein and gene technology, applied in genetic engineering, plant genetic improvement, using vectors to introduce foreign genetic material, etc., can solve problems affecting plants

Active Publication Date: 2014-09-24
CHINA AGRI UNIV
View PDF7 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that some abiotic stresses, such as salt stress, can directly affect plant nodulation and nitrogen fixation, so some tr

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New application of protein derived from clover and its coding genes
  • New application of protein derived from clover and its coding genes
  • New application of protein derived from clover and its coding genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] Embodiment 1, the cloning of MtWRKY76 gene

[0080] 1. Design specific primer pairs (MtWRKY76_5' and MtWRKY76_3'), synthesized by Invitrogen.

[0081] P1F: 5'-

[0082] AGATCTAGATTACAAAGATCATGATGGTGACTATAAGGACCACGACATCGATTACAAAGATGATGATGATAAAATGGAATCAACATGCGTGGAT-3';

[0083] P1R: 5'-GGTGACCTCACCATTTGTCCTTATTAG-3'.

[0084] 2. Extract the RNA from the whole plant of Medicago truncatula (Medicago truncatula) and reverse transcribe it into cDNA;

[0085] 3. Using the cDNA in step 2 as a template, perform PCR amplification on P1F and P1R with the specific primers in step 1, and recover the PCR amplification product.

[0086] 4. Sequencing the PCR amplification product in step 3.

[0087] The sequencing result shows that the gene sequence of the PCR product is sequence 1 in the sequence table, sequence 1 is composed of 938 nucleotides, and the coding region is the 74th-931st nucleotides from the 5' end of sequence 1, from The 1st-7th nucleotides at the 5' end are the B...

Embodiment 2

[0089] Example 2, Obtaining and Functional Research of Transgenic Arabidopsis

[0090] 1. Obtaining transgenic Arabidopsis

[0091] 1. Construction of recombinant vector (pCAMBIA1302-MtWRKY76)

[0092] (1) Digest vector pMD18T-simple-MtWRKY76 with restriction endonucleases BglⅡ and BstEⅡ to recover small fragments.

[0093] (2) pCAMBIA1302 (purchased from the Center for the Application of Molecular Biology to International Agriculture, www.cambia.org) was double digested with restriction endonucleases BglII and BstEII, and the vector skeleton was recovered.

[0094] (3) Ligate the small fragment of step (1) with the vector backbone of step (2) to obtain the ligation product, transform the ligation product into Escherichia coli DH5α, obtain a transformant, extract the plasmid of the transformant, sequence, and sequence the result It shows that the recombinant vector obtained by inserting sequence 1 in the sequence table between the BglⅡ and BstEⅡ restriction sites of pCAMBIA1...

Embodiment 3

[0122] Example 3, Obtaining and functional research of transgenic truncated alfalfa

[0123] 1. Obtaining transgenic truncated alfalfa

[0124] (1) Transformation of truncated alfalfa by vacuum leaf disk transformation method

[0125] The recombinant Agrobacterium EHA105 / pCAMBIA1302-MtWRKY76 in Example 2 was used to infect the leaves of alfalfa R-108, and the alfalfa R-108 was transformed by the method of somatic embryo regeneration by vacuum leaf disc transformation.

[0126] ① Preparation of truncated alfalfa material

[0127] Select the truncated alfalfa R-108 with plump seeds and soak it in concentrated sulfuric acid for about 25 minutes (every 5 minutes, shake gently), until small spots appear on the surface of the seeds, wash it with a large amount of distilled water for 7 times, and ensure that the surface of the seeds is covered with a water film. Put them at 4°C for vernalization for 2 days. Put a layer of filter paper on a large petri dish, moisten it with distill...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a new application of protein derived from clover and its coding genes. The new application provided in the invention is a method for cultivating transgenic nodulation plants with high nodulation capability and/or high stress tolerance by using MtWRKY76 coding nucleic acid molecules. The method for cultivating transgenic nodulation plants with high nodulation capability and/or high stress tolerance provided by the invention comprises the step of introducing the MtWRKY76 gene into a receptor nodulation plant to obtain a transgenic nodulation plant with nodulation capability and/or stress tolerance higher than those of the receptor nodulation plant; the MtWRKY76 is protein as shown in the following a) or b), wherein a) protein with an amino acid sequence as shown in SEQ ID No.2; b) protein which is obtained by substitution and/or deletion and/or addition of one or more than one amino acid residue in SEQ ID No.2, is related to the nodulation capability and/or stress tolerance of nodulation plants, and is derived from a). The new application of the invention has significant value in cultivation of transgenic leguminous crops with salt resistance, drought tolerance, and enhanced nodulation capability.

Description

technical field [0001] The invention relates to a new application of a protein derived from alfalfa and its coding gene. Background technique [0002] The result of the symbiotic interaction between legumes and rhizobia is the development of a new plant organ, the root nodule. The formation of root nodules not only involves molecular dialogue and regulation between symbiotic partners, but also is related to environmental factors, such as water, mineral nutrients, temperature, heavy metals, sodium salts, CO 2 , soil type, and pH. However, so far, little is known about the molecular mechanism of the regulatory mechanism of the nodulation nitrogen fixation process of legumes. Therefore, it is important to discover the key genes in the nodulation nitrogen fixation pathway of legumes and to be familiar with their functions. important means of nodulation's ability to fix nitrogen. [0003] Alfalfa truncated has the characteristics of small genome, 2×8 chromosome number (2n=16),...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82C12N15/29C12N1/13C12N1/15C12N1/19C12N1/21C07K14/415A01H5/00
Inventor 王涛刘丽平董江丽
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap