Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Identification method, kit and universal primer pair for mycobacterium, and application of rpsA gene

A technology of mycobacteria and universal primers, applied in the field of molecular identification of biology and microorganisms, can solve problems that have not been paid attention to

Active Publication Date: 2014-11-26
BEIJING TUBERCULOSIS & THORACIC TUMOR RES INST
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the main focus of mycobacterial species identification technology is its ability to identify NTM to species. In fact, through the use of more molecular markers, it is possible to divide the same NTM into more subtypes and more detailed classification. The subtype is not only helpful for epidemiological research, but when combined with the patient's medical history, it is also possible to establish the relationship between different subtypes and the disease of the patient, so as to understand the immune mechanism and pathogenesis of the host. Similar studies have also been carried out internationally. Not followed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification method, kit and universal primer pair for mycobacterium, and application of rpsA gene
  • Identification method, kit and universal primer pair for mycobacterium, and application of rpsA gene
  • Identification method, kit and universal primer pair for mycobacterium, and application of rpsA gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Amplify and sequence the clinical isolate 110, the sequence is as follows:

[0040] ATCGAGGCCAAGATCATCGAGCTGGACAAGAACCGCAACAACGTGGTGCTGAGCCGCCGCGCCTGGCTGGAGCAGACCCAGTCCGAGGTGCGCAGCGAGTTCCTCAACCAGCTGCAGAAGGGTGCCATCCGCAAGGGTGTCGTCTCCTCGATCGTCAACTTCGGCGCCTTCGTCGATCTCGGCGGTGTCGACGGCCTGGTCCACGTGTCCGAGCTGTCCTGGAAGCACATCGATCACCCGTCCGAGGTGGTTCAGGTGGGCGACGAGGTCACCGTCGAGGTGCTCGACGTCGACATGGATCGCGAGCGGGTTTCGCTGTCGCTCAAGGCGACTCAGGAAGACCCGTGGCGCCACTTCGCCCGCACCCACGCGATCGGTCAGATCGTGCCGGGCAAGGTCACCAAGCTGGTGCCGTTCGGTGCGTTCGTCCGCGTCGAGGAGGGCATCGAGGGTCTGGTGCACATCTCGGAGCTGTCCGAGCGCCACGTCGAGGTCCCGGACCAGGTGGTCCAGGTCGGCGACGACGC(SEQ ID NO:3)

[0041] 2. Using CLUSTAL2.1 software to perform multiple sequence rearrangements on the rpsA gene of clinical isolate 110, and compare the similarity with the standard strain (100% similarity with the standard strain of Mycobacterium fortuitum), and preliminarily identify it as an accidental branch Bacillus ( figure 2 ).

[0042] 3. The phylogenetic tre...

Embodiment 2

[0044] 1. Amplify and sequence the clinical isolate 213, the sequence is as follows:

[0045] ATCGAGGCCAAGATCATCGAGCTGGACACAGACCGCAACAACGTGGTGCTGTCGCGCCGGGCGTGGCTGGAGCAGACGCAGTCCGAGGTGCGCAGCGAGTTCCTCAACCAGCTGCAGAAGGGCGCCATCCGCAAGGGTGTCGTCTCCTCCATCGTCAACTTCGGTGCGTTCGTCGACCTCGGCGGCGTCGACGGTCTGGTGCACGTCTCCGAGCTGAGCTGGAAGCACATCGACCACCCGTCCGAGGTGGTCCAGGTCGGCGACGAGGTCACCGTCGAGGTGCTCGATGTCGACATGGACCGCGAGCGGGTTTCGTTGTCGCTCAAGGCGACTCAGGAAGACCCGTGGCGCCACTTCGCCCGCACCCACGCCATCGGCCAGATCGTGCCCGGCAAGGTCACCAAGCTGGTTCCGTTCGGCGCGTTCGTCCGCGTCGAGGAGGGCATCGAGGGCCTGGTGCACATTTCGGAGCTGGCCGAGCGCCACGTCGAGGTCCCCGACCAGGTGGTTGCCGTCGGCGACGACGC(SEQ ID NO:4)。

[0046] 2. Using CLUSTAL2.1 software to perform multiple sequence rearrangements on the rpsA gene of clinical isolate 213, and compare the similarity with the standard strain (98.3% similarity with the standard strain of Mycobacterium intracellulare), and initially identify it as intracellular Mycobacteria ( Figure 4 ).

[0047] 3. The phylogenetic t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an identification method, a kit and a universal primer pair for mycobacterium and application of an rpsA gene, belonging to the field of molecular strain identification of microorganisms. The rpsA gene is applied in strain identification of mycobacterium and can be obtained through amplification of the universal primer pair including a forward primer and a reverse primer. The universal primer pair comprises the forward primer and the reverse primer and is used for amplification of the rpsA gene of mycobacterium. The species identification method for mycobacterium employs the universal primer pair for PCR amplification so as to obtain an rpsA gene fragment of a to-be-tested strain; and after sequencing, comparison is carried out so as to identify the species of the to-be-tested strain. The classification and identification kit for mycobacterium utilizes the rpsA gene for mycobacterium species identification and comprises PCR technology used for direct detection of the rpsA gene or other detection techniques based on the PCR technology. According to the invention, classification and identification results of the species of mycobacterium are accurate and reliable, the method is simple, and an identification speed is fast; and the universal primer pair can identify most common clinical isolates of non-tuberculosis mycobacteria.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the field of molecular identification of microorganisms; in particular, it relates to a method for identifying mycobacteria, a kit, a pair of universal primers and the application of rpsA gene. Background technique [0002] Tuberculosis remains a serious public health problem, especially in developing countries. According to WHO statistics, 1 / 3 of the world's population is infected with Mycobacterium tuberculosis (MTB), which is the largest killer of infectious diseases in the world. my country is one of the 22 countries with a high burden of tuberculosis in the world, and the number of active tuberculosis patients ranks second in the world. At present, the infection rate of Mycobacterium tuberculosis in all age groups in my country is 44.5%, and about 550 million people in the country are infected by Mycobacterium tuberculosis. Non-tuberculosis mycobacteria (NTM) infection is also on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/689
Inventor 黄海荣刘冠段鸿飞姜广路戴广明
Owner BEIJING TUBERCULOSIS & THORACIC TUMOR RES INST
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More