Identification method, kit and universal primer pair for mycobacterium, and application of rpsA gene
A technology of mycobacteria and universal primers, applied in the field of molecular identification of biology and microorganisms, can solve problems that have not been paid attention to
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Amplify and sequence the clinical isolate 110, the sequence is as follows:
[0040] ATCGAGGCCAAGATCATCGAGCTGGACAAGAACCGCAACAACGTGGTGCTGAGCCGCCGCGCCTGGCTGGAGCAGACCCAGTCCGAGGTGCGCAGCGAGTTCCTCAACCAGCTGCAGAAGGGTGCCATCCGCAAGGGTGTCGTCTCCTCGATCGTCAACTTCGGCGCCTTCGTCGATCTCGGCGGTGTCGACGGCCTGGTCCACGTGTCCGAGCTGTCCTGGAAGCACATCGATCACCCGTCCGAGGTGGTTCAGGTGGGCGACGAGGTCACCGTCGAGGTGCTCGACGTCGACATGGATCGCGAGCGGGTTTCGCTGTCGCTCAAGGCGACTCAGGAAGACCCGTGGCGCCACTTCGCCCGCACCCACGCGATCGGTCAGATCGTGCCGGGCAAGGTCACCAAGCTGGTGCCGTTCGGTGCGTTCGTCCGCGTCGAGGAGGGCATCGAGGGTCTGGTGCACATCTCGGAGCTGTCCGAGCGCCACGTCGAGGTCCCGGACCAGGTGGTCCAGGTCGGCGACGACGC(SEQ ID NO:3)
[0041] 2. Using CLUSTAL2.1 software to perform multiple sequence rearrangements on the rpsA gene of clinical isolate 110, and compare the similarity with the standard strain (100% similarity with the standard strain of Mycobacterium fortuitum), and preliminarily identify it as an accidental branch Bacillus ( figure 2 ).
[0042] 3. The phylogenetic tre...
Embodiment 2
[0044] 1. Amplify and sequence the clinical isolate 213, the sequence is as follows:
[0045] ATCGAGGCCAAGATCATCGAGCTGGACACAGACCGCAACAACGTGGTGCTGTCGCGCCGGGCGTGGCTGGAGCAGACGCAGTCCGAGGTGCGCAGCGAGTTCCTCAACCAGCTGCAGAAGGGCGCCATCCGCAAGGGTGTCGTCTCCTCCATCGTCAACTTCGGTGCGTTCGTCGACCTCGGCGGCGTCGACGGTCTGGTGCACGTCTCCGAGCTGAGCTGGAAGCACATCGACCACCCGTCCGAGGTGGTCCAGGTCGGCGACGAGGTCACCGTCGAGGTGCTCGATGTCGACATGGACCGCGAGCGGGTTTCGTTGTCGCTCAAGGCGACTCAGGAAGACCCGTGGCGCCACTTCGCCCGCACCCACGCCATCGGCCAGATCGTGCCCGGCAAGGTCACCAAGCTGGTTCCGTTCGGCGCGTTCGTCCGCGTCGAGGAGGGCATCGAGGGCCTGGTGCACATTTCGGAGCTGGCCGAGCGCCACGTCGAGGTCCCCGACCAGGTGGTTGCCGTCGGCGACGACGC(SEQ ID NO:4)。
[0046] 2. Using CLUSTAL2.1 software to perform multiple sequence rearrangements on the rpsA gene of clinical isolate 213, and compare the similarity with the standard strain (98.3% similarity with the standard strain of Mycobacterium intracellulare), and initially identify it as intracellular Mycobacteria ( Figure 4 ).
[0047] 3. The phylogenetic t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
