Application of ruxolitinib in the preparation of drugs for the treatment of M2 type acute myeloid leukemia

A technology for acute myeloid leukemia, applied in the field of application of Ruxolitinib in the preparation of drugs for the treatment of M2 type acute myeloid leukemia

Active Publication Date: 2017-01-18
THE FIFTH PEOPLES HOSPITAL OF SHANGHAI FUDAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report about Ruxolitinib as a drug for the treatment of leukemia, especially for the treatment of M2 acute myeloid leukemia.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ruxolitinib in the preparation of drugs for the treatment of M2 type acute myeloid leukemia
  • Application of ruxolitinib in the preparation of drugs for the treatment of M2 type acute myeloid leukemia
  • Application of ruxolitinib in the preparation of drugs for the treatment of M2 type acute myeloid leukemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 In vitro effects of Ruxolitinib and / or rsTRAIL on Kasumi-1 cells

[0049] 1 Materials and methods

[0050] 1.1 Material

[0051] 1.1.1 Cell lines

[0052] Kasumi-1 cells: donated by Professor Zhu Jiang from the Institute of Blood Research of Ruijin Hospital, Shanghai, using a medium containing 10% FBS + RPMI1640 at 37°C, 5% CO 2 , Cultivate in an incubator under saturated humidity, and take log-phase cells for experiment.

[0053] 1.1.2 Main reagents

[0054] Table 1

[0055]

[0056] 1.1.3 Main instruments

[0057] Table 2

[0058]

[0059] 1.2 method

[0060] 1.2.1 Cell culture

[0061] Cell culture conditions: Kasumi-1 cells were inoculated in RPMI1640 medium containing 10% FBS under aseptic conditions, at 37℃, 5% CO 2 Culture in an incubator.

[0062] Cell passage: After the cells are centrifuged at low speed, the supernatant is discarded, the cells are resuspended in 3-5ml medium, and transferred to the culture flask to continue the culture.

[0063] Cryopreservation of ce...

Embodiment 2

[0114] Example 2 Ruxolitinib enhances the mechanism of rsTRAIL on Kasumi-1 cell apoptosis in vitro

[0115] 1. Materials and methods

[0116] 1.1 Material

[0117] 1.1.1 Primer

[0118] According to the human TRAIL, DR4, DR5, DcR1, DcR2, JAK1, JAK2, and mRNA sequences provided by the NCBI database, with β-actin as an internal reference, primers were designed with the software Primer5.0, and synthesized by Shanghai Shenggong Biological Co., Ltd.:

[0119] DR4 primer sequence:

[0120] Forward Primer: 5’aaatgggtacaacaaaactggac3’

[0121] Reverse Primer: 5’gagcctgtgccatcttctaagt3’

[0122] DR5 primer sequence:

[0123] Forward Primer:5’agacttggtgccctttgactc3’

[0124] Reverse Primer: 5’cggttttgttgacccactttat3’

[0125] DcR1 primer sequence:

[0126] Forward Primer: 5’attacaccaacgcttccaaca3’

[0127] Reverse Primer: 5’catctctggggagttttcattc3’

[0128] DcR2 primer sequence:

[0129] Forward Primer: 5’gtgtgtcagtgtgaaaaaggaag3’

[0130] Reverse Primer: 5’aggtagtgatagggagaggcaag3’

[0131] TRAIL primer seq...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to use of Ruxolitinib in preparation of a drug for treating M2 type acute myeloid leukemia with t (8; 21) chromosome translocation, and the in-vitro effective concentration is 1 * 10<-6>-1 *10<-5>M. Drug Ruxolitinib is not only itself has the effect of inhibiting growth and inducing apoptosis on leukemia cell Kasumi-1, and enhances the drug sensitivity of the leukemia cell Kasumi-1 on rsTRAI by up-regulation of mRNA and protein expression level of DR4, up-regulation of cell apoptosis protein Bax expression, activation of apoptosis protein caspase-3 and inhibition of NF-kappa B protein activity. The drug can be used for treating the M2 type acute myeloid leukemia with t (8; 21) chromosome translocation, the new drug for treating the M2 type acute myeloid leukemia with t (8; 21) chromosome translocation is provided, and a new approach for overcoming TRAIL resistance in leukemia cells can be provided.

Description

Technical field [0001] The invention relates to the application of Ruxolitinib in the preparation of a medicine for the treatment of M2 acute myeloid leukemia, in particular to the application of Ruxolitinib in the preparation of a medicine for the treatment of M2 acute myeloid leukemia with t(8; 21) chromosome translocation. Background technique [0002] Leukemia is a malignant clonal disease of hematopoietic stem and progenitor cells. Leukemia cells stop at different stages of cell development due to increased self-renewal, uncontrolled proliferation, differentiation disorders and apoptosis of leukemia cells. In bone marrow and other hematopoietic tissues, leukemia cells proliferate and accumulate in large quantities, which inhibits normal hematopoiesis and infiltrates other organs and tissues. The clinical manifestations are hepatosplenic lymphadenopathy or local masses accompanied by varying degrees of anemia, bleeding, infection and bone pain . Leukemia is a common disease,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K31/519A61K38/17A61P35/02
CPCA61K31/519A61K38/191A61K2300/00
Inventor刘立根庄晏
OwnerTHE FIFTH PEOPLES HOSPITAL OF SHANGHAI FUDAN UNIV