Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Use of Ruxolitinib in preparation of drug for treating M2 type acute myeloid leukemia

A technology for acute myeloid leukemia, applied in the field of application of Ruxolitinib in the preparation of drugs for the treatment of M2 type acute myeloid leukemia

Active Publication Date: 2015-03-11
THE FIFTH PEOPLES HOSPITAL OF SHANGHAI FUDAN UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report about Ruxolitinib as a drug for the treatment of leukemia, especially for the treatment of M2 acute myeloid leukemia.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of Ruxolitinib in preparation of drug for treating M2 type acute myeloid leukemia
  • Use of Ruxolitinib in preparation of drug for treating M2 type acute myeloid leukemia
  • Use of Ruxolitinib in preparation of drug for treating M2 type acute myeloid leukemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 In vitro effect of Ruxolitinib and / or rsTRAIL on Kasumi-1 cells

[0049] 1 Materials and methods

[0050] 1.1 Materials

[0051] 1.1.1 Cell lines

[0052] Kasumi-1 cells: Donated by Professor Zhu Jiang from the Institute of Blood Research, Shanghai Ruijin Hospital, culture medium containing 10% FBS + RPMI1640 at 37°C, 5% CO 2 , cultured in an incubator under saturated humidity, and the cells in the logarithmic phase were taken for experiments.

[0053] 1.1.2 Main reagents

[0054] Table 1

[0055]

[0056] 1.1.3 Main instruments

[0057] Table 2

[0058]

[0059] 1.2 Method

[0060] 1.2.1 Cell culture

[0061] Cell culture conditions: Kasumi-1 cells were inoculated in RPMI1640 medium containing 10% FBS under aseptic conditions at 37°C, 5% CO 2 cultured in an incubator.

[0062] Cell passage: After the cells are centrifuged at low speed, the supernatant is discarded, the cells are resuspended in 3-5ml medium, and the cells are transferred to a...

Embodiment 2

[0114] Example 2 Ruxolitinib enhances the mechanism of rsTRAIL inducing apoptosis in Kasumi-1 cells in vitro

[0115] 1. Materials and methods

[0116] 1.1 Materials

[0117] 1.1.1 Primers

[0118] According to the human TRAIL, DR4, DR5, DcR1, DcR2, JAK1, JAK2, mRNA sequences provided by the NCBI database, with β-actin as an internal reference, the primers were designed with the software Primer5.0 and synthesized by Shanghai Sangon Biotechnology Co., Ltd.:

[0119] DR4 primer sequence:

[0120] Forward Primer: 5'aaatgggtacaacaaaactggac3'

[0121] Reverse Primer: 5'gagcctgtgccatcttctaagt3'

[0122] DR5 primer sequence:

[0123] Forward Primer: 5'agacttggtgccctttgactc3'

[0124] Reverse Primer: 5'cggttttgttgacccactttat3'

[0125] DcR1 primer sequence:

[0126] Forward Primer: 5'attacaccaacgcttccaaca3'

[0127] Reverse Primer: 5'catctctggggagttttcattc3'

[0128] DcR2 primer sequence:

[0129] Forward Primer: 5'gtgtgtcagtgtgaaaaaggaag3'

[0130] Reverse Primer: 5'agg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Concentrationaaaaaaaaaa
Login to View More

Abstract

The invention relates to use of Ruxolitinib in preparation of a drug for treating M2 type acute myeloid leukemia with t (8; 21) chromosome translocation, and the in-vitro effective concentration is 1 * 10<-6>-1 *10<-5>M. Drug Ruxolitinib is not only itself has the effect of inhibiting growth and inducing apoptosis on leukemia cell Kasumi-1, and enhances the drug sensitivity of the leukemia cell Kasumi-1 on rsTRAI by up-regulation of mRNA and protein expression level of DR4, up-regulation of cell apoptosis protein Bax expression, activation of apoptosis protein caspase-3 and inhibition of NF-kappa B protein activity. The drug can be used for treating the M2 type acute myeloid leukemia with t (8; 21) chromosome translocation, the new drug for treating the M2 type acute myeloid leukemia with t (8; 21) chromosome translocation is provided, and a new approach for overcoming TRAIL resistance in leukemia cells can be provided.

Description

technical field [0001] The present invention relates to the application of Ruxolitinib in the preparation of medicaments for treating M2 type acute myeloid leukemia, in particular to the application of Ruxolitinib in the preparation of medicaments for the preparation of M2 type acute myeloid leukemia with t(8;21) chromosome translocation. Background technique [0002] Leukemia is a kind of malignant clonal disease of hematopoietic stem and progenitor cells. Due to the enhanced self-renewal of leukemia cells, uncontrolled proliferation, impaired differentiation and blocked apoptosis, leukemia cells stop leaking at different stages of cell development. In the bone marrow and other hematopoietic tissues, a large number of leukemia cells proliferate and accumulate, inhibiting normal hematopoiesis and infiltrating other organs and tissues. The clinical manifestations are hepatosplenomegaly, lymphadenopathy or local mass with varying degrees of anemia, bleeding, infection and bone ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/519A61K38/17A61P35/02
CPCA61K31/519A61K38/191A61K2300/00
Inventor 刘立根庄晏
Owner THE FIFTH PEOPLES HOSPITAL OF SHANGHAI FUDAN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More