Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Optimized enterotoxigenic escherichia coli-producing polyvalent antigen gene sequence and application thereof in preventing weaned piglet diarrhea

An Escherichia coli, multivalent antigen technology, applied in bacterial antigen components, gene therapy, medical preparations containing active ingredients, etc. Antibody interference and other problems, to achieve comprehensive protective response, synergistically enhance immune response, and improve immune effect

Inactive Publication Date: 2015-05-06
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF2 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these vaccines can induce a certain degree of immune response in suckling piglets, it is not enough to protect piglets from infection
Analyzing the reasons, in addition to the immature development of the immune system of piglets before and after weaning, at least the following points are included: ①After the protein antigens used in the research are taken orally, they are greatly lost when they pass through the gastrointestinal barrier, and the remaining immunogens cannot be effective. Recognized by the immune system of piglets; ② cannot induce enough sIgA at the site of infection, and sIgA is the main force against infection in the mucosal immune response; ③ Maternal antibody interference: targeting pilus adhesin Maternal antibodies, which may render vaccine strains unable to colonize the gut and fail to reach effective bacterial numbers to activate an immune response
④Most of the current research is based on F4, F4 pili or their main subunits FaeG and FedF, and the composition of the immunogen is single
⑤ The immunogen is not effectively delivered to the APC, and the non-specific immunity of the intestine is not fully utilized, and more initial T cells cannot be activated to participate
[0005] To date, no ETEC F4 that causes diarrhea in weaned piglets has been included + The main structural proteins of FaeG, F18 + There are reports on the fusion genes of 6 antigens including receptor binding domain RBD, Stx2e toxin, STa toxin mutant, LT toxin B subunit, and STb toxin, and there is no report on the simultaneous use of molecular peptide CO1 targeting M cells and targeting intestinal tract. The report of the molecular peptide YadA31 and two targeting peptides to enhance the immune response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Optimized enterotoxigenic escherichia coli-producing polyvalent antigen gene sequence and application thereof in preventing weaned piglet diarrhea
  • Optimized enterotoxigenic escherichia coli-producing polyvalent antigen gene sequence and application thereof in preventing weaned piglet diarrhea
  • Optimized enterotoxigenic escherichia coli-producing polyvalent antigen gene sequence and application thereof in preventing weaned piglet diarrhea

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1: Obtaining the optimized ETEC FaeG-F18RBD-Stx2e-STa-LTB-STb-CO1-YadA31 fusion gene fragment

[0053] Acquisition of pre-optimized genes: FaeG (mature peptide), STa-LTB-STb fusion gene obtained in the inventor's previous research (see one of the inventors Gao Fei's master's degree thesis. Targeted lactobacillus expressing F4+ETEC Construction of live bacterial carrier and its immunogenicity analysis. Northeast Agricultural University. 2013), Stx2e (see the article Yufei Feng, Wenxin Liu, Dongfang Shi. Effectiveness of egg folk antibody against Shiga toxin II published by Shi Dongfang, one of the inventors variant toxicity in vitro and in vivo.Curr MICROBIOL,2013,67:448-453.)的基础上,设计引物扩增F18RBD:上游引物P1:5'-ggaactttgacatgccaggctggaactattttggtatggaaaaatgggcgcgaaacccaatatgcgctcgagtgtcgtgtGagcattcaccatag-3',下游引物P2:5'-tttatttccacatgctgtaccgaatcctacttgtgactgttgcccccactgagattcattaatggagccagaactatggtgaatgctcacac -3', the ends of the two primers are complementary, and after ...

Embodiment 2

[0059] Example 2 Preparation of recombinant Lactococcus lactis expressing pig ETEC mFaeG-F18 RBD-Stx2e-STa-LTB-STb-CO1-YadA31 fusion gene

[0060] 1. Construction and identification of recombinant Lactococcus lactis expression vector

[0061] Using primer P1: 5'- ggtaccggatcc tggatgactggtg-3' (restriction sites KpnI, BamHI are underlined) and primer P2:5'- tctagagtcgac ttaacaacctttagcagcaaccatg-3' (restriction sites XbaI and SalI are underlined, stop codons are marked in italics), and the plasmid pUC57-mFaeG-F18RBD-Stx2e-STa-LTB-STb-CO1-YadA31 was used as a template for routine PCR amplification. The gene fragment mFaeG-F18 RBD-Stx2e-STa-LTB-STb with a restriction site and a stop codon was amplified, and cloned into the vector pMD18-T to obtain pMD18-mFaeG-F18 RBD-Stx2e-STa-LTB -STb plasmid. Using primer P1: 5'- ggtaccggatcc tggatgactggtg-3' and primer P2:5'- tctagagtcgac ttatggaagtggtgaac-3' (restriction sites XbaI and SalI are underlined, stop codons are marked in i...

Embodiment 3

[0086] Example 3 Preparation of recombinant Escherichia coli expressing porcine ETEC mFaeG-F18RBD-Stx2e-STa-LTB-STb-CO1-YadA31 fusion gene

[0087] 1. Construction and identification of recombinant Escherichia coli expression vector

[0088] 1) Using restriction enzymes BamH I and Sal I (Takara) to obtain pUC57-mFaeG-F18RBD-Stx2e-STa-LTB-STb-CO1-YadA31 obtained in Example 1 and pMD18-mFaeG-F18RBD obtained in Example 2, respectively - Stx2e-STa-LTB-STb, pMD18-mFaeG-F18RBD-Stx2e-STa-LTB-STb-CO1 and pET28a vectors (Novagen) were digested completely.

[0089] The digestion system is: 1 μg plasmid, 5 μL 10X digestion buffer, 0.5 μL BamH I, 0.5 μL Sal I, add ddH20 to supplement the reaction system to 50 μL. The enzyme digestion reaction conditions are: enzyme digestion at 37°C for 3 hours.

[0090] 2) Use agarose gel electrophoresis to separate the digested products, and use a DNA recovery kit (Shanghai Huasun) to recover a fragment containing a fusion gene of about 2 kb and a fra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an optimized enterotoxigenic escherichia coli (ETEC)-producing polyvalent antigen gene sequence and the application thereof in preventing weaned piglet diarrhea, and belongs to the technical field of biology. The polyvalent antigen gene sequence is synthesized by a large fragment according to the preference of the lactococcus lactis codon, and the synthesized polyvalent antigen gene sequence contains six antigen genes, namely common ETEC dominant serotype F4<+> primary structure protein FaeG causing the weaned piglet diarrhea, the receptor binding domain RBD of F18<+>, and toxins Stx2e and STa mutant, LTB subunit and STb, and molecular peptides CO1 and YadA31 genes targeting the M cells and the intestinal cells, respectively; the genes are connected by GGGGS. The genes are applicable to constructing a lactic acid bacterium living-vector vaccine and remarkably improving the secretory expression quantity of the target protein, and have excellent immunogenicity and protection effect; the genes also are suitable for high-efficiency expression in the escherichia coli; experiments prove that the inclusion body of the genes has excellent immunocompetence and can be taken as the vaccine for preventing the weaned piglets from F4<+> and F18<+> ETEC infection.

Description

technical field [0001] The invention relates to a synthetic codon-optimized polyvalent antigen gene sequence of enterotoxigenic Escherichia coli and an application thereof, belonging to the field of biotechnology. Background technique [0002] Diarrhea in weaned piglets is a long-term problem that plagues pig farms and farmers. It not only brings direct death losses and huge medical expenses, but also indirectly affects the growth rate and breeding rate of rehabilitation pigs in the next stage. The damage is quite serious, and it has become a Important constraints to improving the economic performance of the swine industry worldwide. Enterotoxigenic Esckrichia coli (ETEC) is the main pathogen and an important cause of diarrhea in weaned piglets; among them, F4 + 、F18 + ETEC has a clear dominant position and therefore controls F4 + 、F18 + ETEC infection has become a key link in the prevention and treatment of diarrhea in weaned piglets. It has been reported that most of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C07K19/00C12N1/21A61K39/116A61K39/108A61K48/00A61P31/04A61P1/12C12R1/19C12R1/01
Inventor 葛俊伟马德星李巍师东方赵鹏高菲夏爽关乃瑜谷珊珊崔文姜艳平任皓威
Owner NORTHEAST AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products