Optimized enterotoxigenic escherichia coli-producing polyvalent antigen gene sequence and application thereof in preventing weaned piglet diarrhea
An Escherichia coli, multivalent antigen technology, applied in bacterial antigen components, gene therapy, medical preparations containing active ingredients, etc. Antibody interference and other problems, to achieve comprehensive protective response, synergistically enhance immune response, and improve immune effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1: Obtaining the optimized ETEC FaeG-F18RBD-Stx2e-STa-LTB-STb-CO1-YadA31 fusion gene fragment
[0053] Acquisition of pre-optimized genes: FaeG (mature peptide), STa-LTB-STb fusion gene obtained in the inventor's previous research (see one of the inventors Gao Fei's master's degree thesis. Targeted lactobacillus expressing F4+ETEC Construction of live bacterial carrier and its immunogenicity analysis. Northeast Agricultural University. 2013), Stx2e (see the article Yufei Feng, Wenxin Liu, Dongfang Shi. Effectiveness of egg folk antibody against Shiga toxin II published by Shi Dongfang, one of the inventors variant toxicity in vitro and in vivo.Curr MICROBIOL,2013,67:448-453.)的基础上,设计引物扩增F18RBD:上游引物P1:5'-ggaactttgacatgccaggctggaactattttggtatggaaaaatgggcgcgaaacccaatatgcgctcgagtgtcgtgtGagcattcaccatag-3',下游引物P2:5'-tttatttccacatgctgtaccgaatcctacttgtgactgttgcccccactgagattcattaatggagccagaactatggtgaatgctcacac -3', the ends of the two primers are complementary, and after ...
Embodiment 2
[0059] Example 2 Preparation of recombinant Lactococcus lactis expressing pig ETEC mFaeG-F18 RBD-Stx2e-STa-LTB-STb-CO1-YadA31 fusion gene
[0060] 1. Construction and identification of recombinant Lactococcus lactis expression vector
[0061] Using primer P1: 5'- ggtaccggatcc tggatgactggtg-3' (restriction sites KpnI, BamHI are underlined) and primer P2:5'- tctagagtcgac ttaacaacctttagcagcaaccatg-3' (restriction sites XbaI and SalI are underlined, stop codons are marked in italics), and the plasmid pUC57-mFaeG-F18RBD-Stx2e-STa-LTB-STb-CO1-YadA31 was used as a template for routine PCR amplification. The gene fragment mFaeG-F18 RBD-Stx2e-STa-LTB-STb with a restriction site and a stop codon was amplified, and cloned into the vector pMD18-T to obtain pMD18-mFaeG-F18 RBD-Stx2e-STa-LTB -STb plasmid. Using primer P1: 5'- ggtaccggatcc tggatgactggtg-3' and primer P2:5'- tctagagtcgac ttatggaagtggtgaac-3' (restriction sites XbaI and SalI are underlined, stop codons are marked in i...
Embodiment 3
[0086] Example 3 Preparation of recombinant Escherichia coli expressing porcine ETEC mFaeG-F18RBD-Stx2e-STa-LTB-STb-CO1-YadA31 fusion gene
[0087] 1. Construction and identification of recombinant Escherichia coli expression vector
[0088] 1) Using restriction enzymes BamH I and Sal I (Takara) to obtain pUC57-mFaeG-F18RBD-Stx2e-STa-LTB-STb-CO1-YadA31 obtained in Example 1 and pMD18-mFaeG-F18RBD obtained in Example 2, respectively - Stx2e-STa-LTB-STb, pMD18-mFaeG-F18RBD-Stx2e-STa-LTB-STb-CO1 and pET28a vectors (Novagen) were digested completely.
[0089] The digestion system is: 1 μg plasmid, 5 μL 10X digestion buffer, 0.5 μL BamH I, 0.5 μL Sal I, add ddH20 to supplement the reaction system to 50 μL. The enzyme digestion reaction conditions are: enzyme digestion at 37°C for 3 hours.
[0090] 2) Use agarose gel electrophoresis to separate the digested products, and use a DNA recovery kit (Shanghai Huasun) to recover a fragment containing a fusion gene of about 2 kb and a fra...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 