Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker for diagnosing and treating tumors

A molecular marker and tumor technology, applied in the field of tumor diagnosis, research and treatment, can solve the problem of no research on tumor relationship, achieve the effect of reducing screening cost, improving screening efficiency, and broad development prospects

Active Publication Date: 2015-10-14
SUN YAT SEN UNIV +1
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, polymorphisms of the PLEKHA1 gene are associated with some diseases, including kuhnt-junius degeneration and macular degeneration, and their relationship with tumors has not been studied so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for diagnosing and treating tumors
  • Molecular marker for diagnosing and treating tumors
  • Molecular marker for diagnosing and treating tumors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0035] A molecular marker for tumors, the molecular marker is the fusion gene PLEKHA1-TACC2, and the fusion gene includes part of the sequence of the gene PLEKHA1 and the gene TACC2.

[0036] Preferably, the fusion form of the fusion gene PLEKHA1-TACC2 is selected from: PLEKHA1 exon 2: TACC2 exon 23, PLEKHA1 exon 6: TACC2 exon 13, PLEKHA1 exon 10: TACC2 exon 17, PLEKHA1 exon 2: TACC2 exon 20, PLEKHA1 exon 8. : TACC2 exon 23, PLEKHA1 exon 10: TACC2 exon 23, PLEKHA1 exon 4: TACC2 exon 23, PLEKHA1 exon 3: TACC2 exon 17, PLEKHA1 exon 9: TACC2 exon 23.

[0037] In particular, the fusion gene PLEKHA1-TACC2 contains at least the following sequence:

[0038] PLEKHA1 part:

[0039] TGTAATGTTCAAGCTCAGAAATGCCTTATGTGGATCGTCAGAATCGCATTTGTGGTTTTCTAGACATTGAAGAAAATGAAAACAGTGGGAAATTTCTTCGAAGGTACTTCATACTGGATACCAGAGAAGATAGTTTCGTGTGGTACATGGATAATCCACAG (SEQ ID NO:1);

[0040] TACC2 part:

[0041] AATAAAGAAATAGAAGAACTCACCAAGATTTGTGACGAACTGATTGCCAAAATGGGGAAAAGCTAACTCTGAACCGAATGTTTTGGACTTAACTGTTGCGTGCAATATGACC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker for diagnosing and treating tumors. The molecular marker is a fused gene PLEKHA1-TACC2; and the fused gene simultaneously contains a part of sequences of a gene PLEKHA1 and a gene TACC2. The molecular marker disclosed by the invention is beneficial to early diagnosing and treating tumours, increasing the screening efficiency and reducing the screening cost; a direction is provided for individualized treatment; and the survival rate and the survival quality of patients are improved.

Description

technical field [0001] The invention relates to the fields of tumor diagnosis, research and treatment, in particular to a tumor-specific fusion gene as a molecular marker for tumor diagnosis and a molecular target for clinical treatment. Background technique [0002] With the development of society, changes in people's living environment and eating habits, malignant tumors have become one of the number one killers of human health. a heavy burden. [0003] The occurrence and development of malignant tumors is a multi-step process accompanied by polygenetic or epigenetic changes. Identifying tumorigenic genetic abnormalities is an important goal of cancer research and can provide potential targets for cancer therapy. It is worth noting that the chromosomal rearrangement leads to the fusion of two genes, which plays a key role in the pathogenesis of tumors as a new mutation form, and its discovery expands the category of tumor genes. [0004] Fusion genes, as a new type of t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/62A61K48/00A61K45/00A61K39/395A61P35/00
Inventor 曾木圣林志锐钟茜
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com