Molecular marker for diagnosing and treating tumors
A molecular marker and tumor technology, applied in the field of tumor diagnosis, research and treatment, can solve the problem of no research on tumor relationship, achieve the effect of reducing screening cost, improving screening efficiency, and broad development prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0035] A molecular marker for tumors, the molecular marker is the fusion gene PLEKHA1-TACC2, and the fusion gene includes part of the sequence of the gene PLEKHA1 and the gene TACC2.
[0036] Preferably, the fusion form of the fusion gene PLEKHA1-TACC2 is selected from: PLEKHA1 exon 2: TACC2 exon 23, PLEKHA1 exon 6: TACC2 exon 13, PLEKHA1 exon 10: TACC2 exon 17, PLEKHA1 exon 2: TACC2 exon 20, PLEKHA1 exon 8. : TACC2 exon 23, PLEKHA1 exon 10: TACC2 exon 23, PLEKHA1 exon 4: TACC2 exon 23, PLEKHA1 exon 3: TACC2 exon 17, PLEKHA1 exon 9: TACC2 exon 23.
[0037] In particular, the fusion gene PLEKHA1-TACC2 contains at least the following sequence:
[0038] PLEKHA1 part:
[0039] TGTAATGTTCAAGCTCAGAAATGCCTTATGTGGATCGTCAGAATCGCATTTGTGGTTTTCTAGACATTGAAGAAAATGAAAACAGTGGGAAATTTCTTCGAAGGTACTTCATACTGGATACCAGAGAAGATAGTTTCGTGTGGTACATGGATAATCCACAG (SEQ ID NO:1);
[0040] TACC2 part:
[0041] AATAAAGAAATAGAAGAACTCACCAAGATTTGTGACGAACTGATTGCCAAAATGGGGAAAAGCTAACTCTGAACCGAATGTTTTGGACTTAACTGTTGCGTGCAATATGACC...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap