Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion protein CMFO and application thereof

A fusion protein and protein technology, applied to fusion protein CMFO and its application field, can solve the problem of unsatisfactory effect of preventing latent infection, and achieve the effect of preventing latent infection and reducing the risk of vaccination

Active Publication Date: 2015-11-11
HUAZHONG UNIV OF SCI & TECH
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Aiming at the above defects or improvement needs of the prior art, the present invention provides a fusion protein CMFO and its application, the purpose of which is to produce a fusion protein by selecting an antigen gene and a fusion sequence, and cooperate with an appropriate vaccine adjuvant, thus solving the problem The technical problem that some tuberculosis vaccines are not effective in preventing latent infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein CMFO and application thereof
  • Fusion protein CMFO and application thereof
  • Fusion protein CMFO and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Design and synthesis of fusion gene CMFO sequence and prokaryotic expression primers thereof

[0038] According to the whole gene sequence of M.tbH37Rv, the coding sequences of Rv0577, Rv2875, Rv3044 and Rv2073c were selected. Use Signalp software to predict and search the UniProtKB database to see if the sequence has a signal peptide, and then use DNAMAN software to analyze the restriction site and amino acid sequence. The following principles should be followed when splicing 4 separate target genes: 1) If there is a signal peptide, the signal peptide should be removed, including the original start codon, and the stop codon should be removed at the same time (add TAA after the last spliced ​​gene sequence ); 2) The gene sequence without signal peptide retains the start codon sequence. If the start codon is GTG, because the original expression product is Met instead of Val, GTG needs to be corrected to ATG. The splicing sequence of the fusion protein gene is...

Embodiment 2

[0040] Example 2 Construction of Fusion Protein CMFO Prokaryotic Expression Vector and Protein Purification

[0041] 1. Acquisition of the target gene:

[0042] (1) Primer design: Design primers based on the full sequence of the fusion gene and the multiple cloning site on the prokaryotic expression vector pET30b(+). The primer sequence was synthesized by Shanghai Yingjun Biological Company, and the primer was diluted to 100 pmol / μl according to the instructions. Store at -20°C for later use. The underline in the following primer sequences indicates the enzyme recognition site.

[0043] CMFO-Fwd:

[0044] (NdeI)-TTC CATATG CCCAAGAGAAGCGAATACAGGCAA

[0045] CMFO-Rev:

[0046] (XhoI)-AT CTCGAG TCGCGGCATCCTGCGCCAGACGAAC

[0047] (2) PCR reaction system:

[0048]

[0049] (3) PCR reaction conditions:

[0050] 95℃5min; 94℃1min, 64℃1minand72℃3min, 30cycles; 72℃10min; 4℃forever

[0051] 2. Construction of recombinant plasmids:

[0052] The target gene CMFO with NdeI a...

Embodiment 3

[0062] A tuberculosis subunit vaccine, containing the fusion protein CMFO prepared in Example 2, its concentration is respectively 0.1mg / ml, 0.5mg / ml, 1mg / ml, respectively mixed with DMT adjuvant, equal volume, conventional mechanical vibration or stirring , mixed to form a homogeneous suspension.

[0063] The preparation method of described tuberculosis subunit vaccine is as follows:

[0064] Pipette 100 μl of the fusion protein solution with a working concentration of 0.2 mg / ml and 100 μl of prepared DMT adjuvant into a sterile EP tube, close the tube cap tightly, and oscillate on a vortex shaker for 2 to 3 minutes at intervals to form a uniform milk solution, that is, the tuberculosis subunit vaccine CMFO / DMT was prepared.

[0065] The DMT vaccine adjuvant contains 2mg / ml dimethyl dioctadecyl ammonium (DDA), 0.4mg / ml monophosphoryl lipid (MPL) A, and 0.4mg / ml trehalose (TDB), which is In liposomal form. The trehalose is artificially synthesized 6,6'-dimycolic acid.

[006...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusion protein CMFO applied to preparation of a tuberculosis subunit vaccine. The tuberculosis subunit vaccine contains 0.1mg / ml-1mg / ml fusion protein CMFO. By selecting antigen genes and the fusion sequence, the fusion protein CMFO is prepared, and the fusion protein CMFO is matched with a corresponding vaccine adjuvant DMT to form the tuberculosis subunit vaccine; the tuberculosis subunit vaccine has the good effect for preventing the latent infection of tuberculosis and is high in safety.

Description

technical field [0001] The invention belongs to the field of biomedicine, and more specifically relates to a fusion protein CMFO and its application. Background technique [0002] BCG (Mycobacterium bovis BCG) is the only live attenuated vaccine that is clinically used for the prevention of tuberculosis (TB). At present, the global vaccination coverage of infants and young children is as high as 90% every year. So far, the cumulative number of immunized people has exceeded 3 billion. Extensive clinical and epidemiological studies have confirmed that BCG can effectively prevent primary tuberculosis in infants and young children. However, the immune protection period of BCG vaccine is short, which is generally believed to be only 10-15 years, and it cannot provide stable and ideal protective effect (between 0-80%) for the prevention of adult tuberculosis. According to the WHO report, in 2013, there were 8.6 million registered tuberculosis patients worldwide, of which 8.1 mill...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00A61K39/04A61K39/39A61P31/06
Inventor 范雄林
Owner HUAZHONG UNIV OF SCI & TECH