Construction method of enramycin high-yielding strain and related gene

A technology of enramycin and gene, applied in the field of molecular breeding of industrial microorganisms, to achieve the effect of overcoming the screening work

Active Publication Date: 2015-11-11
TIANJIN UNIV OF SCI & TECH +1
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ribosome engineering of the enramycin-producing strain Streptomyces fungicidicus has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of enramycin high-yielding strain and related gene
  • Construction method of enramycin high-yielding strain and related gene
  • Construction method of enramycin high-yielding strain and related gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0036] The embodiments of the present invention are described in detail below; it should be noted that the embodiments are descriptive, not restrictive, and cannot limit the protection scope of the present invention.

[0037] The applicant made a comparison and designed three sets of mutation primers to produce three mutant sequences at the same time. However, through testing the yield and resistance results, the results of the other two were poor, so the two outer M2 and M3 are no longer specifically provided. The specific sequence and primer sequence.

[0038] All primers involved and used in the M1 sequence are as follows:

[0039] rpsLF1:gtgcctacgatccagcagct

[0040] rpsLR1: acttctccttcttggcgc

[0041] rpsLF2: gccgagttcggcttcttcg

[0042] rpsLR2: acaacctgcaggagcactcc

[0043] S12F1: ccgaattctgaacggcaaggcggtcgc

[0044] S12R1: gcaagcttgcaggtcaagtgaagtggta

[0045] MrpsLR1:accaccccgaacaagccgaa

[0046] MrpsLF1:ttcggcttgttcggggtggt

[0047] The invention belongs to th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a gene and a bacterial strain with good streptomyces fungicidicus enramycin resistance and high yield. The sequence is as shown in a sequence 1. Meanwhile, the invention provides a genetically engineered bacterium containing the gene with good streptomyces fungicidicus enramycin resistance and high yield according to claims. A convenient and fast genetic operation method for streptomyces fungicidicus is built; the physical and chemical mutagenesis blindness and the screening work with a huge project are overcome; coding expression of a ribosome S12 protein gene in streptomyces is changed by a site-specific mutagenesis method; the yield of the bacterial strain produced by enramycin is improved; the resistance capability of the mutated bacterial strain is further detected; and compared with an original bacterial strain, the resistance of the mutant strain on streptomycin is improved by at least 10 times.

Description

technical field [0001] The invention belongs to the field of molecular breeding of industrial microbes, takes the current enramycin production strain Streptomyces fungicidicus F1 as a starting strain, and achieves the purpose of increasing the enramycin production by performing fixed-point transformation on its ribosomal protein coding gene. Background technique [0002] Enramycin, also known as persistent mycin, is a non-ribosomal polypeptide (NRP) antibiotic produced by the fermentation of actinomycetes in the soil, which is harmful to Gram-positive bacteria, especially in the intestinal tract of poultry and livestock Bacillus spp. has a strong inhibitory effect; adding an appropriate amount of enramycin to the feed can not only prevent common animal digestive tract diseases, but also improve the community balance in the intestinal tract of animals, which is beneficial to the digestion and absorption of feed nutrients, and promote animal health. gain weight. At the same t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/76C12N15/31C12N1/21C12R1/01
Inventor 张会图王应东路福平刘东田魏建军
Owner TIANJIN UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap