Method for improving streptomyces bambergiensis bambermycin yield and bacterial strain
A technology of Streptomyces canola and flavomycin, which is applied to the field of increasing the yield of Streptomyces canola, can solve the problems of increasing the yield of Streptomyces canola, and achieves a convenient and quick genetic operation method and increases the output. , the effect of overcoming blindness
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0018] Example: Improving Flavomycin Production by Interrupting the nsdA Gene in a Streptomyces spectae strain
[0019] (1) PCR cloning of a fragment comprising the nsdA gene from the genomic DNA of Streptomyces spectrum
[0020] (a) inoculate Streptomyces spectrum ZM2006 in 30mLTSB culture medium (as described later), cultivate 36hr at 37 ℃, collect mycelium, extract genomic DNA; Template, the universal primer P obtained by bioinformatics analysis 1 : GAAGATCTCATGGACGAGCTGGGCAA and P 2 : GAAGATCTCTTGATCTCGTCGAGCCG PCR amplification, PCR reaction program: 95 ℃ pre-denaturation 5min; 95 ℃ denaturation 45 seconds, 58 ℃ renaturation 1min, 72 ℃ extension 5min, 30 cycles; 72 ℃ extension 5min. Agarose gel electrophoresis detection, a band of about 4.7kb was obtained. (c) carry out agarose gel recovery with the 4.7kb band that (b) obtains, carry out enzyme linkage reaction with carrier pMD18-T (the AT cloning kit purchased from TaKaRa Company); (d) obtain with (c) The enzyme-link...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
