Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker of a clubroot resistance gene in Brassica napus and its application in clubroot resistance breeding

A technology for brassica napus and clubroot resistance, which is applied in the determination/testing of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., and can solve problems that affect the correct selection of disease-resistant materials and the process of breeding, and affect the incidence of inoculation, etc. problem, achieve the effect of improving breeding efficiency and shortening the breeding process

Active Publication Date: 2018-06-15
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the process of the transformation of conventional rapeseed varieties resistant to clubroot, each generation needs to use the method of field inoculation of clubroot to identify the genotype of the intermediate material, and factors such as temperature, humidity, and field distribution of the pathogen will affect the incidence of inoculation , which in turn affects the correct selection of disease-resistant materials and the process of breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker of a clubroot resistance gene in Brassica napus and its application in clubroot resistance breeding
  • Molecular marker of a clubroot resistance gene in Brassica napus and its application in clubroot resistance breeding
  • Molecular marker of a clubroot resistance gene in Brassica napus and its application in clubroot resistance breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Acquisition and identification of a marker closely linked to the clubroot resistance gene PbBa8.1 in Brassica napus

[0026] 1. Construction of isolated groups

[0027]Identification of novel QTLs for isolate-specific partial resistance to Plasmodiophora brassicae in Brassica rapa.[J].Plos One,2013,8(12) :e85307-e85307) as the male parent and the susceptible conventional Brassica napus Huashuang 5 as the female parent to obtain F1. The disease resistance of F1 was identified with the Huangshan physiological race in Anhui, and all F1 showed disease resistance. Next, we continued to backcross F1 with Huashuang 5 for three generations, and obtained backcross populations of BC1, BC2, and BC3 respectively. At the same time, we used the SSR markers cum_m090a and sau_um353a linked to the PbBa8.1 site to start Genotype analysis was performed on the BC1 population, and individual plants that might contain the PbBa8.1 site were screened out for subsequent backcrossing work unti...

Embodiment 2

[0042] The application of the molecular marker A08-300 closely linked to the clubroot resistance gene PbBa8.1 in the auxiliary selection of Brassica napus resistant to clubroot. The application process includes:

[0043] 35 resistant individual plants and 27 susceptible individual plants were randomly selected from the BC3F2 population prepared in Example 1, and genotype identification was performed on them using two pairs of SSR primers cun_m090a, sau_um353a and Indel marker A08-300.

[0044] Utilize the identification process of primer FA08-300 / R A08-300 provided by the present invention to comprise:

[0045] 1. Genomic DNA extraction

[0046] 1. Add 498uL 1×CTAB extract (2% CTAB, 100mmol / L Tris-HCl, 20mmol / L EDTA, 1.4mol / L NaCl) and 2uL β-mercaptoethanol to a 1.5ml centrifuge tube, shake well;

[0047] 2. Take 0.2g of young leaves, grind them to powder under liquid nitrogen conditions, add them to a centrifuge tube containing CTAB extract and β-mercaptoethanol, and shake w...

Embodiment 3

[0067] Application of molecular marker A08-300 primer closely linked to clubroot resistance gene PbBa8.1 in auxiliary selection of Brassica napus resistant to clubroot:

[0068] Using the disease-resistant molecular marker primers provided by the present invention, the BC3F2 generation plants derived from the BC3 single plant of ZHE-226 in Example 1 were subjected to genotype analysis and agronomic trait selection, and a homozygous disease-resistant locus (i.e. Using primers FA08-300 / R A08-300 to amplify 132bp single plant), 200 single plants with relatively consistent growth period and good agronomic traits were obtained by selfing BC3F3 mixed population.

[0069] In May 2015, field disease resistance identification was carried out again in the clubroot disease area in Badong, Enshi, Hubei, and field phenotype investigation was carried out 45 days after sowing. From the perspective of the overall effect in the field, compared with the new disease-resistant strain we transferr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker of the clubroot disease resistance gene PbBa8.1 of Brassica napus and its application in clubroot disease resistance breeding. The invention uses the method of resequencing to detect the genes around the PbBa8.1 site of the two parents. After the polymorphism analysis of the sequence, the flanking sequence of the Indel site was used for primer development and design, and then DNA molecular markers capable of distinguishing Brassica napus resistant to clubroot and not resistant to clubroot were obtained. Design primers for this molecular marker: F A08‑300: 5'‑GTAGTGCGGGCCACAAAAT‑3'; R A08‑300: 5'‑CACAATGGAGTGTTGAAATTCACT‑3', which can be used to improve the speed and identification efficiency of clubroot resistance gene selection , the method is easy to implement, has good repeatability, strong operability, fast identification speed, low detection cost, saves time and labor, and greatly reduces the workload of selecting disease-resistant single plants through phenotypic identification in the field.

Description

technical field [0001] The present invention relates to the flanking genome sequence of the molecular marker A08-300 closely linked to the PbBa8.1 site of the brassica napus resistance gene PbBa8.1, the primers designed according to the flanking sequence, and the primers used in screening rapeseed against clubroot application. Background technique [0002] Clubroot disease is a highly contagious soil disease caused by the infection of Plasmodiophora brassicae, a flagellate subphylum. Clubroot fungus parasitizes exclusively on the roots of Brassicaceae, radish and Arabidopsis and other cruciferous plants. When the root system is stimulated by pathogens, its parenchyma cells divide and enlarge in large numbers to form tumors. Due to the suppression of the physiological function of the root, the aboveground part of the diseased plant shows symptoms such as leaf chlorosis, dullness, yellowing of the leaf edge, slow growth, short plant and wilting. When the disease is severe, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/6895
Inventor 张椿雨战宗祥朴钟云江莹芬吴江生周永明傅廷栋
Owner HUAZHONG AGRI UNIV