Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of varroa mite toxic protein and its coding gene and application

A virulent protein, Varroa destructor technology, applied in the field of biochemistry and molecular biology

Active Publication Date: 2018-01-19
INST OF ZOOLOGY GUANGDONG ACAD OF SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But this uncapping and removal behavior is not specific to Varroa mites, but a general cleaning behavior, targeting all foreign substances or larvae endangered by microorganisms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of varroa mite toxic protein and its coding gene and application
  • A kind of varroa mite toxic protein and its coding gene and application
  • A kind of varroa mite toxic protein and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] 1. Cloning of toxin protein gene

[0015] Get about 60 Varroa mites, use TriZolReagent (Invitrogen Company, its article number: 15596026) to extract total RNA, use agarose gel electrophoresis and ultraviolet spectrophotometer to detect the purity and amount of total RNA, and take 1 μg of total RNA to make Initiate the reverse transcription reaction, the reverse transcription kit used is SMARTer TM RACE cDNA Amplification Kit (Clontech, catalog number: 634923), the reverse transcription reaction steps refer to the instructions of the kit to obtain the reverse transcription product.

[0016] Using the reverse transcription product as a template, design specific primers for the VMP gene:

[0017] VMPF1 (5'ATGTTCAAACTTCTCGTTATCG3')

[0018] VMPR1 (5'TTAGGAGGCGAGCGCCTGCTGGA3')

[0019] Use high-fidelity Taq enzyme for PCR. The PCR reaction system is: reverse transcription product 1 μL, 10xBuffer 5 μL, dNTP (each 2.5 mM) 4 μL, VMPF1 (10 μM) 1 μL, VMPR1 (10 μM) 1 μL, Taq e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a varroa mite toxic protein, its coding gene and application. The present invention clones a new coding gene VMP of a new Varroa mite poisonous protein VMP from the genome of the Varroa mite, and its expression product VMP has a toxic effect on honeybees, so the Varroa mite of the present invention can be The varroa mite poisonous protein VMP and its coding gene are applied to the preparation of bee-killing medicine. The invention also creates conditions for the basic scientific research on the mechanism of the Varroa dessica harming honeybees.

Description

Technical field: [0001] The invention belongs to the field of biochemistry and molecular biology, and specifically relates to a toxic protein of Varroa dissimilar mite, its coding gene and its application. Background technique: [0002] Varroa mite has always been one of the most important hazards to beekeeping in the world, and it has not been found in Australia only in the world (Zhou Ting, 2005; Rosenkranz et al., 2010). Varroa dissimilar sucks the body fluids of adult bees or larvae of bees, resulting in the decline of bee physique, and at the same time reduces the cognitive ability and sense of direction of bees (Kralj et al., 2007), reduces the return rate of busy bees, and shortens the lifespan of bees (Dainat et al., 2012), the bee colony is weakened. Most importantly, Varroa dissociates also transmit bacterial and viral diseases of bees (Tentcheva et al., 2004; Yan et al., 2009; Prisco et al., 2011, Ai et al., 2012), and suppress host immunity by suppressing The r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12A01N47/44A01P7/04
Inventor 张祎韩日畴
Owner INST OF ZOOLOGY GUANGDONG ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com