Stomach disease detection kit
A kit and technology for stomach diseases, applied in the direction of disease diagnosis, measuring devices, biochemical equipment and methods, etc., can solve the problems of unfavorable large-scale promotion and high price, and achieve good application prospects, easy storage, repeatability and stability Good results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] The preparation of embodiment 1 human pepsinogen II
[0027] According to the method disclosed in CN103387971A, the recombinant human pepsinogen II isozyme chimeric protein is prepared to obtain human pepsinogen II, and the protein concentration is 100 mg / mL.
Embodiment 2
[0028] Example 2 Synthetic random single-stranded DNA library and primers
[0029] Random single-stranded DNA (ssDNA) library: 5'-
[0030] TACGACATGAACCGTGATAA (N42)CAGTGAAACCTGATGATCGA-3', constructed a random ssDNA library with a length of 82nt, with fixed primer sequences at both ends, a random sequence of 42 bases in the middle, and a library capacity of 10 14 Above; Primer 1: 5'-TACGACATGAACCGTGATAA-3'; Primer 2: 5'-TCGATCAGCAGGTTTCACTG-3'; The random ssDNA library and the two primers were prepared into 100 μmol / L stock solution with TE buffer and stored at 20°C for later use.
[0031] The single-stranded DNA library is amplified into double-stranded DNA, and the product is subjected to 2% agarose gel electrophoresis and then gel-cut to recover and purify; the recovered double-stranded DNA is used as a template to transcribe a single-stranded RNA random library in vitro, and the transcript is purified by PAGE . 75 μg RNA library was reverse-screened through nitrocellul...
Embodiment 3
[0060] Example 3 The performance measurement of protein binding suitable gametes
[0061] 2.0 μg of aptamers were digested with calf intestinal alkaline phosphatase (CIP) at 37°C for 1 h, and the dephosphorylated RNA was purified and recovered; the dephosphorylated RNA was labeled with [γ-32P]ATP by T4 polynucleotide kinase end of RNA molecule. 10nmol of radioactively labeled aptamers were incubated with different concentrations (1-200nM) of human pepsinogen II at 37°C for 30min, and the reaction solution of each group was filtered through a nitrocellulose membrane, washed, dried, and counted by liquid scintillation The radioactivity remaining on the filter membrane was measured by the instrument, and the same sample was measured twice in parallel. Calculate the dissociation constant between each aptamer and the target protein. The result is as follows:
[0062]
[0063]
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap