Stomach disease detection kit

A kit and technology for stomach diseases, applied in the direction of disease diagnosis, measuring devices, biochemical equipment and methods, etc., can solve the problems of unfavorable large-scale promotion and high price, and achieve good application prospects, easy storage, repeatability and stability Good results

Inactive Publication Date: 2016-08-24
卢美珍
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It is known in the prior art that time-resolved fluorescence measurement technology is used, and the TRFIIA kit of PGII is currently one of the most sensitive and widest measurement methods in PGII detection methods, but the high price is not conducive to large-scale promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Stomach disease detection kit
  • Stomach disease detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] The preparation of embodiment 1 human pepsinogen II

[0027] According to the method disclosed in CN103387971A, the recombinant human pepsinogen II isozyme chimeric protein is prepared to obtain human pepsinogen II, and the protein concentration is 100 mg / mL.

Embodiment 2

[0028] Example 2 Synthetic random single-stranded DNA library and primers

[0029] Random single-stranded DNA (ssDNA) library: 5'-

[0030] TACGACATGAACCGTGATAA (N42)CAGTGAAACCTGATGATCGA-3', constructed a random ssDNA library with a length of 82nt, with fixed primer sequences at both ends, a random sequence of 42 bases in the middle, and a library capacity of 10 14 Above; Primer 1: 5'-TACGACATGAACCGTGATAA-3'; Primer 2: 5'-TCGATCAGCAGGTTTCACTG-3'; The random ssDNA library and the two primers were prepared into 100 μmol / L stock solution with TE buffer and stored at 20°C for later use.

[0031] The single-stranded DNA library is amplified into double-stranded DNA, and the product is subjected to 2% agarose gel electrophoresis and then gel-cut to recover and purify; the recovered double-stranded DNA is used as a template to transcribe a single-stranded RNA random library in vitro, and the transcript is purified by PAGE . 75 μg RNA library was reverse-screened through nitrocellul...

Embodiment 3

[0060] Example 3 The performance measurement of protein binding suitable gametes

[0061] 2.0 μg of aptamers were digested with calf intestinal alkaline phosphatase (CIP) at 37°C for 1 h, and the dephosphorylated RNA was purified and recovered; the dephosphorylated RNA was labeled with [γ-32P]ATP by T4 polynucleotide kinase end of RNA molecule. 10nmol of radioactively labeled aptamers were incubated with different concentrations (1-200nM) of human pepsinogen II at 37°C for 30min, and the reaction solution of each group was filtered through a nitrocellulose membrane, washed, dried, and counted by liquid scintillation The radioactivity remaining on the filter membrane was measured by the instrument, and the same sample was measured twice in parallel. Calculate the dissociation constant between each aptamer and the target protein. The result is as follows:

[0062]

[0063]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a stomach disease detection kit, and belongs to the technical field of in-vitro reagent diagnosis. The stomach disease detection kit is characterized in that a nucleic acid aptamer which can be specifically combined with pepsinogen II is screened by a SELEX (systematic evolution of ligands by exponential enrichment) technique, the pepsinogen II in blood is specifically screened or detected by the nucleic acid aptamer, and the nucleic acid aptamer is prepared into the detection kit, so that the direct reaction for detection without thinning of blood is realized, and the workload is decreased; the measuring range is wide, and the stomach disease detection kit is suitable for clinical application. The stomach disease detection kit has the beneficial effects that the sensitivity is high, the specificity is good, the measuring range is wide, the operation is simple, the stomach disease detection kit is suitable for large-scale popularization and application, and the market prospect is broad.

Description

[0001] This application is a divisional application of an invention patent application with an application date of November 29, 2015, an application number of 201510849189.6, and an invention title of "A Kit for Stomach Disease Detection". technical field [0002] The application relates to the field of biological detection, in particular to the detection of stomach diseases. Background technique [0003] Pepsinogen II (PG II for short) comes from the whole gastric gland and Brunner's gland in the distal duodenum. The PGII synthesized by the gastric mucosa is about 25% of the total. Most of PG II enters the digestive tract and a small amount enters the blood circulation. Therefore, it is called "a pointer reflecting the state and function of the stomach". [0004] Clinical studies at home and abroad have pointed out that PG II has a greater correlation with fundic mucosal lesions, and its increase is related to fundic duct atrophy, intestinal metaplasia or pseudopyloric glan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/573
CPCC12N15/115C12N2310/16G01N33/573G01N2333/96477G01N2800/06G01N2800/062
Inventor 卢美珍
Owner 卢美珍
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap