Supercharge Your Innovation With Domain-Expert AI Agents!

G enterovirus detection antibody double sandwich ELISA detection kit

A technology of enterovirus and enzyme-labeled antibody, applied in the biological field, can solve the problems of lack of research on virus detection and diagnosis methods and its prevention and control, and achieve the effects of not affecting the normal production of animals, improving sensitivity and specificity, and being convenient to use

Active Publication Date: 2020-07-10
JILIN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is a lack of research on the detection and diagnosis methods of the virus and its prevention and treatment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • G enterovirus detection antibody double sandwich ELISA detection kit
  • G enterovirus detection antibody double sandwich ELISA detection kit
  • G enterovirus detection antibody double sandwich ELISA detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of recombinant plasmid for prokaryotic expression of G type enterovirus structural protein VP1

[0031] 1. Primer design

[0032] According to the base composition of the target sequence, design primers for amplification VP1 The upstream and downstream of the gene contain EcoRI and XhoI restriction sites respectively. The primer sequences are as follows:

[0033] Upstream primer: 5' TT GAATTC CAGGCTGGGTATGTGACT 3' (EcoRI)

[0034] Downstream primer: 5'T CTCGAG TTAATGAAAATCACTGAGGGGTT 3' (XhoI)

[0035] 2. Gene amplification

[0036] Genomic RNA of G enteroviruses was extracted by the conventional Trizol method, and cDNA was obtained by using a commercially available conventional reverse transcription kit according to the instructions, and amplified using it as a template VP1 Gene, PCR reaction system:

[0037]

[0038] PCR operating conditions: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 1.5 min, annealing at 54°C for...

Embodiment 2

[0041] Example 2 Expression and purification of VP1 recombinant protein

[0042]After the identified positive recombinant plasmid pGEX-4T-1-VP1 was transformed into Escherichia coli BL21(DE3) competent cells, plated and incubated overnight at 37°C, a single colony was picked and inoculated into 3 mL of 100 µg / mL ampicillin containing Cultivate overnight in LB liquid medium, then inoculate 1 mL of the above culture into 200 mL of LB liquid medium containing 100 μg / mL ampicillin and culture at 37 °C until logarithmic growth phase (OD 600 =0.6), adding IPTG (final concentration 1 mmol / L), inducing culture at 20°C for 3 h, and detecting by SDS-PAGE, the recombinant target protein VP1 was obtained, as figure 2 Shown (lane 2). Centrifuge the bacterial cells, and after ultrasonic disruption, wash with 1.5M urea for 3 times to obtain high-purity recombinant protein, such as figure 2 Shown (lane 3).

Embodiment 3

[0043] Example 3 Preparation of Anti-Sheep Enterovirus VP1 Recombinant Protein Monoclonal Antibody and Polyclonal Antibody

[0044] 1. Preparation of anti-VP1 monoclonal antibody: select 6-8 week-old healthy BALB / c mice to emulsify and purify VP1 recombinant protein with complete Freund's adjuvant, and inject 100 μg subcutaneously into each mouse at multiple points, and then every 14 days Boost the immunization once in the same way, and collect serum to test the titer at the same time. For the last booster immunization, 100 μg of purified protein was directly injected intraperitoneally. After 3 to 5 days, the splenocytes of the immunized mice were mixed with SP2 / 0 in a fusion tube, centrifuged at 300 g for 10 min, the supernatant was discarded, and the cells were shaken to make the two Mix the seeded cells as evenly as possible, then slowly add the preheated PEG-4000 solution dropwise within 60 sec, and then slowly add serum-free 1640 medium to terminate the fusion, let it sta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a double-antibody sandwich ELISA kit for detecting a G type enterovirus pathogen. The VP1 gene of which the base sequence is shown as the sequence table SEQ ID NO.1 is adopted to express VP1 protein, BALB / C mice are immunized to prepare a monoclonal antibody which is the captured antibody, adult healthy rabbits are immunized to prepare a polyclonal antibody, and horse radish peroxidase (HRP) is marked. Both the safety and the RT-PCR detection results meet 100% coincidence rate. The kit can be preserved at 4 DEG C for 6 months, and the detecting results have no obvious difference from that of the conventional method.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a double-antibody sandwich ELISA kit for detecting G kinds of enterovirus pathogens. Background technique [0002] According to the latest classification of viruses, the Picornaviridae Enterovirus genus includes nine species of enteroviruses: A, B, C, D, E, F, G, H and J. These enteroviruses are important pathogens that cause respiratory and digestive tract and central nervous system diseases in humans and animals. Among them, enteroviruses A, B, C and D cause human infections; enteroviruses E, F and G cause animal infections, such as enteroviruses E and F in cattle and enterovirus G in pigs , has caused serious harm to human health and the healthy development of animal husbandry. Sheep enterovirus infection is a new clinical disease at home and abroad, mainly characterized by digestive tract and respiratory tract. There is no report on the detection and diagno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/10G01N33/577G01N33/569G01N33/535
CPCC07K16/1009G01N33/535G01N33/56983G01N33/577G01N2333/085
Inventor 王新平鲁海冰王明月朱利塞郭昌明刘亚静张群王芳
Owner JILIN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More