Inducible Promoter of Lilium Minjiang and Its Application

A promoter and inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve the problems of protein accumulation and energy waste, achieve broad application prospects and protect plants

Active Publication Date: 2018-10-23
KUNMING UNIV OF SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In genetic engineering, if the foreign gene transferred to the plant is not controlled, it will be expressed in large quantities in the plant, resulting in a large amount of protein accumulation and a waste of energy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Inducible Promoter of Lilium Minjiang and Its Application
  • Inducible Promoter of Lilium Minjiang and Its Application
  • Inducible Promoter of Lilium Minjiang and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter LrP1

[0024] Using the extracted Genomic DNA of Lily of the Minjiang River as a template, the specific primers for amplifying the promoter LrP1 (upstream primer: 5'TCGAGTTTGGTGTTATTGTTATTAG3'', downstream primer: 5'GATGTGTTTGAGAAGGAGGTGT3') were used as upstream and downstream primers, and the promoter was cloned by PCR Sequence of LrP1. The reaction system (20 μL) was 0.5 μg of Genomic DNA of Lily Minjiang, 2 μL of 10×Advantage 2 PCR Buffer, 1.8 μL of dNTP Mix (10mM each), 0.2 μL of upstream primer (10 μM), 0.2 μL of downstream primer (10 μM), 0.2 μL Advantage 2 PCR Polymerase Mix, 14.6 μL PCR-Grade Water. PCR reaction conditions: 94°C for 5 min; 32 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 2 min; 72°C for 5 min. After PCR, 8 μL was taken for agarose gel electrophoresis to detect the specificity and size of the amplified product.

[0025] The PCR product obtained has only one ...

Embodiment 2

[0028] Example 2: LrP1 -GUS Expression vector construction

[0029] The pBI121 multiple cloning site has Hin dⅢ and Bam HI restriction sites, so specific primers for amplifying promoters were added Hin dⅢ and Bam HI recognition site. The Escherichia coli plasmid pGEM-T-LrP1 inserted into LrP1 and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 1 μL was used for agarose gel electrophoresis to detect the extracted The integrity and concentration of the plasmid. restriction endonuclease Bam HI and Hin dⅢ Carry out double digestion of plasmids pGEM-T-LrP1 and pBI121 respectively (100 μL system). The reaction system and operation process are as follows: take 20 μL pGEM-T-LrP1 and pBI121 plasmids respectively, add 10 μL 10×H buffer, 5 μL Bam HI, 5 μL Hin dIII, 60 μL ddH 2 O, after mixing, centrifuge for a short time, and place at 37°C for overnight reaction. All digested p...

Embodiment 3

[0032] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants

[0033] The transgenic recipient in this experiment was tobacco. The tobacco seeds were soaked in 75% alcohol for 30 s, washed with sterile water and washed with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8 days, transfer to light incubator after germination (25°C, 16h / d light), Subculture once a month with MS medium.

[0034] The pBI121-LrP1 containing pBI121-LrP1 -GUS The plasmid Agrobacterium LBA4404 bacterial fluid was taken out, and 10 μL of the bacterial fluid was inoculated into 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L Km, and cultured with shaking at 200 rpm at 28 °C until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 20 mg / L rifampicin and 50 mg / L Km, and culture it upside down at 28°C until a lawn gro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lilium regale inducible promoter LrP1 and application thereof. A nucleotide sequence of the LrP1 is as shown in SEQ ID NO: 1. According to the lilium regale inducible promoter LrP1 disclosed by the invention, the technical research related to molecular biology and gene engineering verifies that the lilium regale inducible promoter LrP1 is in response to several plant hormones and biotic and abiotic stress; expression cassettes constructed by connecting the lilium regale inducible promoter LrP1 disclosed by the invention and beta-glucuronidase genes are shifted into tobacco for expression, the activity of glucuronidase of transgene tobacco can be quantitatively detected through a fluorescence method, and a result shows that the activity of the glucuronidase is remarkably enhanced after the transgene tobacco is treated by gibberellin, ethylene, abscisic acid, NaCl, damage factors, fusarium oxysporum, sclerotinia sclerotiorum and botrytis cinerea; therefore, the lilium regale inducible promoter LrP1 is induced by several hormones and biotic and abiotic stress factors, so that the lilium regale inducible promoter LrP1 can be used for plant stress-resistant gene engineering.

Description

technical field [0001] The invention relates to the research fields of molecular biology and genetic engineering, in particular to an inducible promoter LrP1 and its application. Background technique [0002] The promoter is a DNA sequence located upstream of the 5' end of the structural gene, which can activate RNA polymerase to accurately combine with the template DNA and have the specificity of transcription initiation. Common promoters in plants include constitutive promoters, tissue-specific promoters, and inducible promoters. Constitutive promoter refers to that under the control of this type of promoter, the expression of structural genes is generally constant at a certain level, and there is no obvious difference in the expression level in different tissues and parts. Tissue-specific promoters, also known as organ-specific promoters, are divided into root-specific promoters, stem-specific promoters, and the like. Under the regulation of such promoters, genes are of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00
CPCC07K14/415C12N15/8237
Inventor刘迪秋关瑞攀曲媛杨野葛锋何华
OwnerKUNMING UNIV OF SCI & TECH