HCV NS3 Monoclonal Antibody and Hepatitis C Detection Kit

A monoclonal antibody, hepatitis C technology, applied in measuring devices, anti-viral immunoglobulins, instruments, etc., can solve the problems of HCAgNS3 detection rate limitation, reduce steric hindrance effect, easy and fast operation, and improve sensitivity Effect

Active Publication Date: 2019-04-16
BEIJING INST OF HEPATOLOGY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, detecting the NS3 antigen in the blood of infected persons is the most ideal HCV infection detection target, however, the concentration of HCAg NS3 in serum (10 2 ~10 3 CID / ml) is often lower than the detection limit (0.1ng / ml~1μg / ml) of the most commonly used enzyme-linked immunosorbent assay (ELISA) at home and abroad, which greatly limits the detection rate of HCAg NS3 and becomes HCV Bottleneck in Antigen Detection Reagent Development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HCV NS3 Monoclonal Antibody and Hepatitis C Detection Kit
  • HCV NS3 Monoclonal Antibody and Hepatitis C Detection Kit
  • HCV NS3 Monoclonal Antibody and Hepatitis C Detection Kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The establishment of embodiment 1HCV NS3 monoclonal antibody

[0029] 1. Antigen preparation:

[0030] (1) Construction of the expression plasmid: use the full-length sequence of HCV NS3 as a template, use the following primers, synthesize gene fragments by PCR, perform gel recovery and purification of PCR products, transform and connect them into PMD18T (sequencing vector) by conventional methods, and perform sequencing verification .

[0031] Primer design and cloning: Design upstream and downstream primers according to the full-length sequence of human HCV NS3 in GenBank (FJ890494.1), as shown in SEQ ID No.1 and SEQ ID No.2:

[0032] Upstream SEQ ID No.1: atgctaggcaccataatcacaa

[0033] Downstream SEQ ID No.2: cactgctttatccacacccgg

[0034] The PCR reaction cycle parameters are: 94°C, 4min; 94°C, 30s; 55°C, 30s; 72°C, 1min, 20 cycles, 72°C extension 4min.

[0035] (2) Expression and purification of target protein: HCV NS3 gene (465bp) was amplified with primers c...

Embodiment 2

[0063] Embodiment 2 Preparation of nano magnetic beads hepatitis C detection kit of the present invention

[0064] 1. Preparation of Immunomagnetic Beads (MIB)

[0065] The microspheres used in this example can be patent No. ZL201010168903.2, the microspheres described in the patent name "A Method for Synthesizing Magnetic Polymer Microspheres", or other commercially available superparamagnetic polymer microspheres .

[0066] Take 1 mg streptavidin-modified magnetic microspheres, wash once with MIB washing buffer, add 100 μl biotin-labeled HCV NS3 monoclonal antibody HCV4, mix well, react at room temperature for 30 minutes, magnetically separate, absorb the supernatant, and measure protein concentration, washed three times with MIB washing buffer, added 1ml MIB storage buffer, and stored at 4°C for later use.

[0067] 2. Identification of the coupling efficiency of antibodies on the surface of immunomagnetic beads

[0068] The OD value of the antibody solution (pre) before ...

Embodiment 4

[0082] Embodiment 4 The application experiment verification of the hepatitis C detection kit of the present invention in clinical specimen detection

[0083] 1. Detection of 3708 HCV antibody-negative serum samples:

[0084] HCV antibody was completed by Wantai Hepatitis C-Hepatitis C Virus (HCV) Antibody Diagnostic Kit (Double Antigen Sandwich Enzyme Linked Immunoassay, S20130002), collected from Beijing You'an Hospital from January 2003 to December 2005 The serum specimen (-80 ℃ preservation) that stays, wherein 48 examples detect HCV NS3 antigen-positive (1.3%), and the detection OD value of antigen-positive patient is shown in Table 8 and is that kit of the present invention detects 48 routine HCV antibody negative, HCV NS3 OD value of antigen-positive patients (>0.168 is positive).

[0085] Table 8 HCV Antibody Negative Serum Sample HCV NS3 Antigen Positive Detection Results

[0086]

[0087]

[0088] 2. HCV NS3 antigen detection in 173 HCV antibody-positive patient...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a hybridoma cell strain HCV4, wherein the preservation number of the cell strain is CGMCC No.10120. The invention discloses a hybridoma cell strain HCV5, wherein the preservation number of the cell strain is CGMCC No.12282. Two monoclonal antibody hybridoma cell strains HCV4 and HCV5, for epitope 'MWTVYHGAG' and epitope 'TRKGSSGGP' of HCV NS3 N terminal, are prepared by the invention, and the two monoclonal antibodies, in the matched detection of an HCV NS3 antigen, are quite high in sensitivity and specificity. The monoclonal antibodies have an early detection advantage, namely infection in a patient can be detected within about one week. The monoclonal antibodies are high in sensitivity, and average detection sensitivity is 5.2pg / ml, which is much lower than ELISA detection method in the prior art which is 1-2ng / ml.

Description

technical field [0001] The invention relates to a detection kit, in particular to a hepatitis C detection kit and its special HCVNS3 monoclonal antibody hybridoma cell lines HCV4 and HCV5 and the monoclonal antibody secreted by the cell lines. Background technique [0002] Hepatitis C is a kind of infectious disease that seriously threatens people's health caused by hepatitis C virus (HCV). More than 50% of HCV patients will develop chronic hepatitis, and 10-20% of HCV patients will eventually develop liver cirrhosis. At the same time, the risk of hepatocellular carcinoma is also greatly increased. The detection of HCV is of great significance to the early diagnosis of hepatitis C virus infection and the guidance of clinical treatment. At present, the detection of hepatitis C is mainly based on the two detection indicators of hepatitis C antibody and hepatitis C RNA. After HCV infection, there is an average "window period" of 70 days before the detection of hepatitis C anti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N5/20C07K16/10G01N33/576G01N33/577C12R1/91
CPCC07K16/109C07K2317/76G01N33/5767G01N33/577
Inventor谢立石英刘芳孟超关素梅左松博
OwnerBEIJING INST OF HEPATOLOGY