Application of AtCIPK23 gene in improvement of plant capacity of tolerance to iron deficiency
A technology of transgenic plants and plants, applied in applications, plant peptides, plant products, etc., can solve problems such as poor iron absorption capacity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1, AtCIPK23 Gene Knockout Effects on Plant Phenotypes
[0056] Disinfect the seeds of AtCIPK23 gene mutants lks1-2, lks1-3 and wild-type Arabidopsis col-0 (WT, purchased from Arabidopsis Biological Resource Center (ABRC stocks, product catalog number is CS60000), and sow them on iron-supplying agarose for cultivation. base (Fe 3+ -EDTA at a concentration of 50 μM), vernalization in the dark at 4°C for 3 days, moved to an artificial climate chamber for 5 days, and then transferred the seedlings to low-iron medium (Fe 3+ -EDTA at a concentration of 0.5 μM) and iron-sufficient medium (Fe 3+ -EDTA at a concentration of 50 μM) for 5 days and treated with iron deficiency. There were 120 seeds for each strain, the experiment was repeated three times, and the results were averaged.
[0057] 1) Phenotype
[0058] Observe the phenotype of the plants grown in low-iron or iron-sufficient medium for 5 days, harvest the aboveground parts of the plants, and measure the abo...
Embodiment 2
[0069] Embodiment 2, AtCIPK23 gene overexpression improves plant resistance to low iron stress
[0070] 1. Construction of transgenic Arabidopsis thaliana
[0071] 1. Construction of AtCIPK23 overexpression recombinant vector
[0072] According to the coding region sequence of AtCIPK23, the 5' end primer was designed: 5'-CGTAGTTGGAATAGGTTC ATGGCTTCTCGAACAACGCC -3' (coding region underlined), 3' end primer: 5'-CCAGTATGGAGTTGGGTTC TTATGTCGACTGTTTTGC -3' (the coding region is underlined).
[0073] Cut about 0.2g of wild-type Arabidopsis seedlings and grind them in liquid nitrogen; then add 800 μL of freshly prepared extraction buffer (0.1M pH8.0 Tris-HCl; 50mM EDTA; 0.5M NaCl; 1% SDS; 1% β-mercaptoethanol), shake vigorously to suspend it; incubate in a water bath at 65°C for 30 minutes, mix by inverting every 5 minutes; then add 250 μL of pre-cooled 5M potassium acetate, mix by inverting immediately, and place on ice for 5 minutes; add Equal amount of phenol / chloroform, ext...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



