Check patentability & draft patents in minutes with Patsnap Eureka AI!

Cre-LoxP condition-based GLCCI1 gene knockout mouse model constructing kit and constructing method

A gene knockout mouse, construction method technology, applied in genetic engineering, chemical instruments and methods, biochemical equipment and methods, etc., can solve the problem of unclear function of GLCCI1 gene

Inactive Publication Date: 2017-05-31
XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF1 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the function of the GLCCI1 gene is still unclear. The construction of a GLCCI1 gene knockout mouse model will facilitate in-depth research on the function of GLCCI1 and its pathogenesis in related diseases, and provide a possible role for the treatment of these diseases target

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cre-LoxP condition-based GLCCI1 gene knockout mouse model constructing kit and constructing method
  • Cre-LoxP condition-based GLCCI1 gene knockout mouse model constructing kit and constructing method
  • Cre-LoxP condition-based GLCCI1 gene knockout mouse model constructing kit and constructing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] 1. Preparation of GLCCI1 conditional gene knockout mice

[0045] 1.1 Targeting carrier construction

[0046] Design and conception of targeting principles for GLCCI1 in the genome. The GLCCI1 targeting vector uses a BAC vector containing the GLCCI1 gene. The homologous recombination arm of GLCCI1 was obtained by using the BAC vector set containing GLCCI1, and the 1 st -loxp inserts upstream of exon 2, putting 2 nd -loxp was inserted downstream of exon 2, and the target targeting vector was obtained by PCR sequencing and enzyme digestion. The constructed vector was identified by PCR and digestion with ApaLI, BglII, KpnI, and PstI, and the bands were identified by photographing the product after electrophoresis. The primers identified by PCR targeting vector were GLCCI1-FRT-tF:CTGCTTTGAGGTCTTCATCTGC; GLCCI1-FRT-tR:CTTACAGTGCCTCCTCATTACC.

[0047] 1.2 ES cell screening and identification

[0048] The constructed targeting vector was linearized, and the linearized tar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Cre-LoxP condition-based GLCCI1 gene knockout mouse model constructing kit, and a targeting vector and a constructing method of the above mouse model. A loxP sequence is respectively arranged at two ends of a target sequence of GLCCI1 by using a Cre / loxP principle to obtain a flox mouse, the flox mouse and a mouse with a systematic knockout Cre line are mated to obtain a systematic GLCCI1 gene knockout mouse line, and the obtained GLCCI1 gene knockout mouse is applied to the function researches of the GLCCI1 gene and proteins.

Description

technical field [0001] The invention belongs to the field of preparation technology and cell construction of biological and medical experiment models. It involves the construction kit, targeting vector and construction method of the GLCCI1 gene-based Cre-LoxP conditional gene knockout mouse model. Background technique [0002] The GLCCI1 gene, the glucocorticoid-induced transcriptional gene 1, is located in the 3rd subband (7p21.3) of the 2nd band 1 band of the short arm of chromosome 7, contains 8 exons, and is present in various tissues throughout the body expressed in all organs. GLCCI1 was first described by Chapman et al., who found that after dexamethasone stimulation of thymus-derived cell lines, there were significant differences in the expression of certain gene sequence tags in hormone-sensitive and hormone-insensitive cells. It has been reported in the literature that GLCCI1 is related to the occurrence of various diseases and the efficacy of hormone therapy, in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A01K67/027
CPCC12N15/8509A01K67/0276A01K2217/077A01K2217/15A01K2227/105C07K14/47C12N2800/107C12N2800/30
Inventor 冯俊涛荀秋芬李晓照胡成平胡新月唐薇罗丽莎
Owner XIANGYA HOSPITAL CENT SOUTH UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More