Cre-LoxP condition-based GLCCI1 gene knockout mouse model constructing kit and constructing method
A gene knockout mouse, construction method technology, applied in genetic engineering, chemical instruments and methods, biochemical equipment and methods, etc., can solve the problem of unclear function of GLCCI1 gene
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] 1. Preparation of GLCCI1 conditional gene knockout mice
[0045] 1.1 Targeting carrier construction
[0046] Design and conception of targeting principles for GLCCI1 in the genome. The GLCCI1 targeting vector uses a BAC vector containing the GLCCI1 gene. The homologous recombination arm of GLCCI1 was obtained by using the BAC vector set containing GLCCI1, and the 1 st -loxp inserts upstream of exon 2, putting 2 nd -loxp was inserted downstream of exon 2, and the target targeting vector was obtained by PCR sequencing and enzyme digestion. The constructed vector was identified by PCR and digestion with ApaLI, BglII, KpnI, and PstI, and the bands were identified by photographing the product after electrophoresis. The primers identified by PCR targeting vector were GLCCI1-FRT-tF:CTGCTTTGAGGTCTTCATCTGC; GLCCI1-FRT-tR:CTTACAGTGCCTCCTCATTACC.
[0047] 1.2 ES cell screening and identification
[0048] The constructed targeting vector was linearized, and the linearized tar...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


