A kind of Escherichia coli fusion expression plectasin, its preparation method and application

A technology of plectasin and Escherichia coli, applied in application, chemical instruments and methods, expression enhancement stability/folded protein fusion, etc., can solve the problem of high cost, unsuitable for antibacterial drug preparations, health care products or preservatives, impact Problems such as the expression of plectasin antimicrobial peptides, to achieve soluble expression and reduce production costs

Active Publication Date: 2020-11-13
WUHU TIANMING BIOTECH CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] At present, there have been some researches on the expression of plectasiacin gene engineering at home and abroad, but because the pphaceasin antimicrobial peptide has antibacterial effect, the expression host such as Escherichia coli expresses the plectasiacin antimicrobial peptide will feedback inhibit the activity of host cells , affect the further expression of plectasin antibacterial peptides, so yeast expression is often used in the genetic engineering research of plectasin antimicrobial peptides, or expression in Escherichia coli plus a large fusion protein is performed together to remove the fusion protein tag and purify However, the cost of the two different expression methods is relatively high, and it is not suitable for widespread use in animal feed additives, antibacterial drug preparations, health products or preservatives, so there is no mature plectasin antimicrobial peptide product on the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Escherichia coli fusion expression plectasin, its preparation method and application
  • A kind of Escherichia coli fusion expression plectasin, its preparation method and application
  • A kind of Escherichia coli fusion expression plectasin, its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 Preparation process of hyphamycin fusion protein

[0022] (1) Design and synthesis of mycelium fusion protein gene

[0023] According to published literature (Mygind PH, et al. Nature, 2005; 437(13):975-980), the amino acid sequence of the saprophytic ascomycete hyphamycin and the amino acid of thioredoxin (Trx) in Genbank Sequence, and then design the hyphamycin fusion protein gene with reference to the E. coli preferred codons. The hyphamycin and Trx are connected by GGGGS flexible Linker. The designed gene sequence is as follows:

[0024] CATATG AGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCGGACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCAAAACCCTGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCC GGTGGCGGTGGTAGTATGGGCTTTGGCTGTAATGGTCCGTGG GATGAAGATGATATGCAGTGCCATAATCATTGTAAATCTATCAAAGGCTACAAAG...

Embodiment 2

[0031] Example 2 Bacteriostatic and Bactericidal Experiments of Hyphamycin Fusion Protein

[0032] (1) The disc method detects the antibacterial effect of hyphamycin fusion protein

[0033] The tested strains were clinical methicillin-resistant Staphylococcus aureus MRSA15471114, MRSA15471118 and penicillin-resistant Streptococcus pneumonia PRSP31355. Staphylococcus aureus MRSA15471114 and MRSA15471118 were cultured on MH medium, and penicillin-resistant Streptococcus pneumoniae PRSP31355 contained 5%. Sheep blood was cultured in MH medium, cultured at 37°C to OD600 = 0.5, and 100 μL of bacterial solution was evenly spread on the agar plate. Place the autoclaved paper evenly on the surface of the agar plate, and drop 30 μL of 1 mg / mL hyphaomycin and 10 μL of 1 mg / mL cephalexin on the paper respectively. Take 30μL ddH dropwise 2 O's paper was used as a negative control. The results showed that the hyphamycin fusion protein has antibacterial effect on three clinically resistant bac...

Embodiment 3

[0036] Example 3 Acute toxicity test of mycelium fusion protein in mice

[0037] The purpose of this experiment is to observe whether the hyphamycin fusion protein has toxic effects on mice. Forty healthy BALB / c mice, half male and half male, weighing 22±0.31g. The hyphamycin fusion protein was 1 mg / mL, intramuscularly injected once a day, 0.1 mL / time, for 7 consecutive days, and the toxicity of mice was observed. The experimental results showed that the mice had no abnormal reactions during the test, their diet and activities were normal, and all 40 mice survived. The mice were sacrificed, and the heart, liver, lung, spleen, kidney, gastrointestinal and other organs were observed to be normal. Prove that the mycelium fusion protein has no toxicity to animals.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fusion expression plectasin, a preparation method and application thereof. The amino acid sequence of the recombinant plectasin is SEQ ID NO:1; and a nucleotide sequence designed according to an escherichia coli preferred codon is SEQ ID NO:2. According to the invention, a prokaryotic expression vector is utilized to construct the escherichia coli BL21 (DE3) host strain capable of expressing plectasin-thioredoxin fusion protein. The strain is subjected to multiplication culture, isopropyl-beta-D-isopropylthiogalactoside induction expression is carried out, centrifugation is performed to harvest thallus, the thallus is cracked, then centrifugation is conducted to acquire the supernatant, and affinity chromatography purification is carried out to obtain plectasin fused protein, the growth of gram positive staphylococcus aureus, streptococcus pneumoniae and the like can be significantly inhibited without removing thioredoxin by enzyme digestion. According to the invention, plectasin fused protein has obvious bacteriostatic effect without removing fusion protein by enzyme digestion, and the production cost is greatly reduced.

Description

Background technique [0001] Antimicrobial peptides are a kind of small peptide substances widely existing in natural organisms. It is an important part of the body's innate immune system. Because antimicrobial peptides have a wide range of inhibitory effects on bacteria, fungi, parasites, viruses, tumor cells, etc., and with the emergence of more and more antibiotic-resistant microorganisms, antimicrobial peptides have a good reputation in the pharmaceutical industry and food additives. Application prospects. Mycelium is a kind of fungal defensin, which is a kind of antibacterial peptide. The mature functional fragment of hyphamycin has 40 amino acids and its molecular weight is 4.4kD. Its biological activity is mainly manifested in its strong bactericidal effect on Gram-positive bacteria, especially Streptococcus pneumoniae and Streptococcus pyogenes. , Staphylococcus aureus, etc., have an antibacterial effect equivalent to penicillin and vancomycin. Studies have shown that ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/62C12N15/70C07K19/00A23K20/147A23L33/195A23L3/3535A61K38/16A61K47/64A61P31/04
CPCA23L3/3535A23V2002/00A61K38/00C07K14/37C07K2319/35C12N15/70A23V2200/10A23V2250/546
Inventor赵俊甘霖王明丽
OwnerWUHU TIANMING BIOTECH CO LTD