A kind of Escherichia coli fusion expression plectasin, its preparation method and application
A technology of plectasin and Escherichia coli, applied in application, chemical instruments and methods, expression enhancement stability/folded protein fusion, etc., can solve the problem of high cost, unsuitable for antibacterial drug preparations, health care products or preservatives, impact Problems such as the expression of plectasin antimicrobial peptides, to achieve soluble expression and reduce production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1 Preparation process of hyphamycin fusion protein
[0022] (1) Design and synthesis of mycelium fusion protein gene
[0023] According to published literature (Mygind PH, et al. Nature, 2005; 437(13):975-980), the amino acid sequence of the saprophytic ascomycete hyphamycin and the amino acid of thioredoxin (Trx) in Genbank Sequence, and then design the hyphamycin fusion protein gene with reference to the E. coli preferred codons. The hyphamycin and Trx are connected by GGGGS flexible Linker. The designed gene sequence is as follows:
[0024] CATATG AGCGATAAAATTATTCACCTGACTGACGACAGTTTTGACACGGATGTACTCAAAGCGGACGGGGCGATCCTCGTCGATTTCTGGGCAGAGTGGTGCGGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCAGGGCAAACTGACCGTTGCAAAACTGAACATCGATCAAAACCCTGGCACTGCGCCGAAATATGGCATCCGTGGTATCCCGACTCTGCTGCTGTTCAAAAACGGTGAAGTGGCGGCAACCAAAGTGGGTGCACTGTCTAAAGGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCC GGTGGCGGTGGTAGTATGGGCTTTGGCTGTAATGGTCCGTGG GATGAAGATGATATGCAGTGCCATAATCATTGTAAATCTATCAAAGGCTACAAAG...
Embodiment 2
[0031] Example 2 Bacteriostatic and Bactericidal Experiments of Hyphamycin Fusion Protein
[0032] (1) The disc method detects the antibacterial effect of hyphamycin fusion protein
[0033] The tested strains were clinical methicillin-resistant Staphylococcus aureus MRSA15471114, MRSA15471118 and penicillin-resistant Streptococcus pneumonia PRSP31355. Staphylococcus aureus MRSA15471114 and MRSA15471118 were cultured on MH medium, and penicillin-resistant Streptococcus pneumoniae PRSP31355 contained 5%. Sheep blood was cultured in MH medium, cultured at 37°C to OD600 = 0.5, and 100 μL of bacterial solution was evenly spread on the agar plate. Place the autoclaved paper evenly on the surface of the agar plate, and drop 30 μL of 1 mg / mL hyphaomycin and 10 μL of 1 mg / mL cephalexin on the paper respectively. Take 30μL ddH dropwise 2 O's paper was used as a negative control. The results showed that the hyphamycin fusion protein has antibacterial effect on three clinically resistant bac...
Embodiment 3
[0036] Example 3 Acute toxicity test of mycelium fusion protein in mice
[0037] The purpose of this experiment is to observe whether the hyphamycin fusion protein has toxic effects on mice. Forty healthy BALB / c mice, half male and half male, weighing 22±0.31g. The hyphamycin fusion protein was 1 mg / mL, intramuscularly injected once a day, 0.1 mL / time, for 7 consecutive days, and the toxicity of mice was observed. The experimental results showed that the mice had no abnormal reactions during the test, their diet and activities were normal, and all 40 mice survived. The mice were sacrificed, and the heart, liver, lung, spleen, kidney, gastrointestinal and other organs were observed to be normal. Prove that the mycelium fusion protein has no toxicity to animals.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


