A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 probe and its application
A tumor cell and immunofluorescence technology, which is applied in the field of biomedical clinical detection, can solve the problems of finding target CTCs and restricting the application of FISH technology, and achieve the effect of reducing identification errors, detection time, and counting errors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 fluorescence in situ hybridization probe, the composition of the kit is shown in Table 1 below:
[0042] Table 1 Kit Composition
[0043]
Embodiment 2
[0045] Using the kit described in Example 1 to identify circulating tumor cells in lung cancer patients, the CD45 monoclonal antibody+chromosome 8 fluorescent in situ hybridization probe used was used for detection, and the fluorescent in situ hybridization probe specific sequence for chromosome 8 (SEQ ID NO.1 )for:
[0046] TTGAAACACTCTTTTTGTAGAATCTGCAGGTGGATATTTGGCTAGCTTTGAGGATTTCGTTGGAAACGGTAATGTCTTCAAAGAAAATCTAGACAGAAGCATTCTCAGAAACAGCGTCGTGATGTTTGCAATCAAGTCACAGAG
[0047] Specifically include the following steps:
[0048] (1) Harvest cells: suck the captured circulating tumor cell samples (CTCs) into a conical centrifuge tube, centrifuge at 1000 rpm for 10 min, and remove the supernatant;
[0049] (2) Hypotonicity: Add 6-8 mL of 0.075 mol / L KCL solution pre-warmed to 37°C, blow and mix with a straw, and place in a 37°C incubator for 20-30 minutes;
[0050] (3) Pre-fixation: Add 2 mL of fixative, mix by pipetting, and centrifuge at 1000 rpm for 10 min;
[0051] (4) Aspir...
Embodiment 3
[0064] Using the kit described in the embodiment of the present invention, CD45 immunofluorescence and CEP8 fluorescence in situ hybridization are used to jointly detect peripheral blood samples of pancreatic cancer patients. The sequence (SEQ ID NO.1) of the CEP8 fluorescence in situ hybridization probe is:
[0065] TTGAAACACTCTTTTTGTAGAATCTGCAGGTGGATATTTGGCTAGCTTTGAGGATTTCGTTGGAAACGGTAATGTCTTCAAAGAAAATCTAGACAGAAGCATTCTCAGAAACAGCGTCGTGATGTTTGCAATCAAGTCACAGAG
[0066] Specifically include the following steps:
[0067] (1) Harvesting cells: extract 10ml of peripheral blood from the patient, and use a commercially available circulating tumor cell capture instrument or kit to capture circulating tumor cells (CTCs). The captured circulating tumor cells are sucked into a conical centrifuge tube, centrifuged, and rotated at 1000 / min, 10min, remove the supernatant;
[0068] (2) Hypotonicity: Add 6-8 mL of 0.075 mol / L KCL solution pre-warmed to 37°C, blow and mix with a straw, and p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



