Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 probe and its application

A tumor cell and immunofluorescence technology, which is applied in the field of biomedical clinical detection, can solve the problems of finding target CTCs and restricting the application of FISH technology, and achieve the effect of reducing identification errors, detection time, and counting errors

Active Publication Date: 2018-09-18
WUHAN HEALTHCHART BIOLOGICAL TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When fluorescence in situ hybridization technology is applied to the detection of CTCs chromosome polyploidy, gene breakage and gene fusion, due to the presence of a large number of blood cell backgrounds in the captured CTCs, it is extremely difficult to find target CTCs under a fluorescence microscope, which limits the use of FISH technology. Applications in CTCs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 probe and its application
  • A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 probe and its application
  • A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 probe and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 fluorescence in situ hybridization probe, the composition of the kit is shown in Table 1 below:

[0042] Table 1 Kit Composition

[0043]

Embodiment 2

[0045] Using the kit described in Example 1 to identify circulating tumor cells in lung cancer patients, the CD45 monoclonal antibody+chromosome 8 fluorescent in situ hybridization probe used was used for detection, and the fluorescent in situ hybridization probe specific sequence for chromosome 8 (SEQ ID NO.1 )for:

[0046] TTGAAACACTCTTTTTGTAGAATCTGCAGGTGGATATTTGGCTAGCTTTGAGGATTTCGTTGGAAACGGTAATGTCTTCAAAGAAAATCTAGACAGAAGCATTCTCAGAAACAGCGTCGTGATGTTTGCAATCAAGTCACAGAG

[0047] Specifically include the following steps:

[0048] (1) Harvest cells: suck the captured circulating tumor cell samples (CTCs) into a conical centrifuge tube, centrifuge at 1000 rpm for 10 min, and remove the supernatant;

[0049] (2) Hypotonicity: Add 6-8 mL of 0.075 mol / L KCL solution pre-warmed to 37°C, blow and mix with a straw, and place in a 37°C incubator for 20-30 minutes;

[0050] (3) Pre-fixation: Add 2 mL of fixative, mix by pipetting, and centrifuge at 1000 rpm for 10 min;

[0051] (4) Aspir...

Embodiment 3

[0064] Using the kit described in the embodiment of the present invention, CD45 immunofluorescence and CEP8 fluorescence in situ hybridization are used to jointly detect peripheral blood samples of pancreatic cancer patients. The sequence (SEQ ID NO.1) of the CEP8 fluorescence in situ hybridization probe is:

[0065] TTGAAACACTCTTTTTGTAGAATCTGCAGGTGGATATTTGGCTAGCTTTGAGGATTTCGTTGGAAACGGTAATGTCTTCAAAGAAAATCTAGACAGAAGCATTCTCAGAAACAGCGTCGTGATGTTTGCAATCAAGTCACAGAG

[0066] Specifically include the following steps:

[0067] (1) Harvesting cells: extract 10ml of peripheral blood from the patient, and use a commercially available circulating tumor cell capture instrument or kit to capture circulating tumor cells (CTCs). The captured circulating tumor cells are sucked into a conical centrifuge tube, centrifuged, and rotated at 1000 / min, 10min, remove the supernatant;

[0068] (2) Hypotonicity: Add 6-8 mL of 0.075 mol / L KCL solution pre-warmed to 37°C, blow and mix with a straw, and p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedicine clinical detection, and particularly relates to a kit applying CD45 immunofluorescence combined with a CEP8 fluorescent in-situ hybridization probe for one-step process co-dyeing to identify circulating tumor cells and application thereof. The kit comprises fixing liquid, 2xSSC, 0.3%NP-40 / 0.4xSSC, 0.075M KCI solution, CD45 monoclonal antibody and CEP 8 probe mixed liquid, DAPI counter stain, perforating agent, closing liquid and mounting medium. The CD45 immunofluorescence antibody is combined with the CEP8 fluorescent in-situ hybridization probe to identify captured circulating tumor cells, and immunofluorescence and fluorescent in-situ hybridization detection are completed through a one-step process, so that the problems of mutual interference and long detection time when immunofluorescence detection and fluorescent in-situ hybridization detection are combined are solved; hybridization incubation through the one-step process is completed quickly within 2h, so that detection time is greatly reduced, and detection results are visual to observe.

Description

technical field [0001] The invention belongs to the field of biomedical clinical detection, and in particular relates to a kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 fluorescence in situ hybridization probes and an application thereof. Background technique [0002] Circulating tumor cells (CTCs) refer to all kinds of tumor cells present in peripheral blood, which are released from solid tumor lesions (primary tumors, metastases) and enter peripheral blood circulation due to spontaneous or therapeutic operations. Most CTCs undergo apoptosis or are phagocytized after entering the peripheral blood, and a few can escape and anchor and develop into metastases. In recent years, the clinical performance of CTCs in tumor diagnosis, treatment and monitoring has gradually emerged. It is currently the most promising means of non-invasive tumor diagnosis and real-time efficacy monitoring, and its clinical application value is extremely ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/533C12Q1/6886
CPCC12Q1/6841C12Q1/6888G01N33/533G01N33/56966G01N33/577C12Q2537/143C12Q2563/107
Inventor 叶伦李雪梅李倩程弘夏陈刚
Owner WUHAN HEALTHCHART BIOLOGICAL TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com