Kit applying CD45 immunofluorescence combined with CEP 8 probe to identify circulating tumor cells and application thereof
A tumor cell and immunofluorescence technology, which is applied in the field of biomedical clinical detection, can solve the problems of finding target CTCs and restricting the application of FISH technology, and achieve the effect of reducing identification errors, detection time, and counting errors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 fluorescence in situ hybridization probe, the composition of the kit is shown in Table 1 below:
[0042] Table 1 Kit composition
[0043]
Embodiment 2
[0045] Using the kit described in Example 1 to identify circulating tumor cells in lung cancer patients, the CD45 monoclonal antibody + chromosome 8 fluorescence in situ hybridization probe was used for detection, and the chromosome 8 fluorescence in situ hybridization probe-specific sequence (SEQ ID NO.1 )for:
[0046] TTGAAACACTCTTTTTGTAGAATCTGCAGGTGGATATTTGGCTAGCTTTGAGGATTTCGTTGGAAACGGTAATGTCTTCAAAGAAAATCTAGACAGAAGCATTCTCAGAAACAGCGTCGTGATGTTTGCAATCAAGTCACAGAG
[0047] Specifically include the following steps:
[0048] (1) Harvest cells: suck the captured circulating tumor cell samples (CTCs) into a conical centrifuge tube, centrifuge at 1000 rpm for 10 min, and remove the supernatant;
[0049] (2) Hypotonicity: add 6-8 mL of 0.075mol / L KCL solution pre-warmed to 37°C, blow and beat with a pipette and mix well, then place in a 37°C incubator for 20-30 minutes;
[0050] (3) Pre-fixation: add 2 mL of fixative solution, mix by pipetting, and centrifuge at 1000 rpm for 10 min;...
Embodiment 3
[0064] Using the kit described in the embodiment of the present invention, CD45 immunofluorescence and CEP8 fluorescence in situ hybridization are used to detect the peripheral blood samples of pancreatic cancer patients. The sequence of the CEP8 fluorescence in situ hybridization probe (SEQ ID NO. 1) is:
[0065] TTGAAACACTCTTTTTGTAGAATCTGCAGGTGGATATTTGGCTAGCTTTGAGGATTTCGTTGGAAACGGTAATGTCTTCAAAGAAAATCTAGACAGAAGCATTCTCAGAAACAGCGTCGTGATGTTTGCAATCAAGTCACAGAG
[0066] Specifically include the following steps:
[0067] (1) Harvesting cells: extract 10 ml of peripheral blood from patients, use a commercially available circulating tumor cell capture instrument or kit to capture circulating tumor cells (CTCs), and suck the captured circulating tumor cells into a conical centrifuge tube, centrifuge at 1000 rpm / min, 10min, remove supernatant;
[0068] (2) Hypotonicity: add 6-8 mL of 0.075mol / L KCL solution pre-warmed to 37°C, blow and beat with a pipette and mix well, then place in a...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com