Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit applying CD45 immunofluorescence combined with CEP 8 probe to identify circulating tumor cells and application thereof

A tumor cell and immunofluorescence technology, which is applied in the field of biomedical clinical detection, can solve the problems of finding target CTCs and restricting the application of FISH technology, and achieve the effect of reducing identification errors, detection time, and counting errors

Active Publication Date: 2017-07-21
WUHAN HEALTHCHART BIOLOGICAL TECH
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When fluorescence in situ hybridization technology is applied to the detection of CTCs chromosome polyploidy, gene breakage and gene fusion, due to the presence of a large number of blood cell backgrounds in the captured CTCs, it is extremely difficult to find target CTCs under a fluorescence microscope, which limits the use of FISH technology. Applications in CTCs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit applying CD45 immunofluorescence combined with CEP 8 probe to identify circulating tumor cells and application thereof
  • Kit applying CD45 immunofluorescence combined with CEP 8 probe to identify circulating tumor cells and application thereof
  • Kit applying CD45 immunofluorescence combined with CEP 8 probe to identify circulating tumor cells and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP 8 fluorescence in situ hybridization probe, the composition of the kit is shown in Table 1 below:

[0042] Table 1 Kit composition

[0043]

Embodiment 2

[0045] Using the kit described in Example 1 to identify circulating tumor cells in lung cancer patients, the CD45 monoclonal antibody + chromosome 8 fluorescence in situ hybridization probe was used for detection, and the chromosome 8 fluorescence in situ hybridization probe-specific sequence (SEQ ID NO.1 )for:

[0046] TTGAAACACTCTTTTTGTAGAATCTGCAGGTGGATATTTGGCTAGCTTTGAGGATTTCGTTGGAAACGGTAATGTCTTCAAAGAAAATCTAGACAGAAGCATTCTCAGAAACAGCGTCGTGATGTTTGCAATCAAGTCACAGAG

[0047] Specifically include the following steps:

[0048] (1) Harvest cells: suck the captured circulating tumor cell samples (CTCs) into a conical centrifuge tube, centrifuge at 1000 rpm for 10 min, and remove the supernatant;

[0049] (2) Hypotonicity: add 6-8 mL of 0.075mol / L KCL solution pre-warmed to 37°C, blow and beat with a pipette and mix well, then place in a 37°C incubator for 20-30 minutes;

[0050] (3) Pre-fixation: add 2 mL of fixative solution, mix by pipetting, and centrifuge at 1000 rpm for 10 min;...

Embodiment 3

[0064] Using the kit described in the embodiment of the present invention, CD45 immunofluorescence and CEP8 fluorescence in situ hybridization are used to detect the peripheral blood samples of pancreatic cancer patients. The sequence of the CEP8 fluorescence in situ hybridization probe (SEQ ID NO. 1) is:

[0065] TTGAAACACTCTTTTTGTAGAATCTGCAGGTGGATATTTGGCTAGCTTTGAGGATTTCGTTGGAAACGGTAATGTCTTCAAAGAAAATCTAGACAGAAGCATTCTCAGAAACAGCGTCGTGATGTTTGCAATCAAGTCACAGAG

[0066] Specifically include the following steps:

[0067] (1) Harvesting cells: extract 10 ml of peripheral blood from patients, use a commercially available circulating tumor cell capture instrument or kit to capture circulating tumor cells (CTCs), and suck the captured circulating tumor cells into a conical centrifuge tube, centrifuge at 1000 rpm / min, 10min, remove supernatant;

[0068] (2) Hypotonicity: add 6-8 mL of 0.075mol / L KCL solution pre-warmed to 37°C, blow and beat with a pipette and mix well, then place in a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedicine clinical detection, and particularly relates to a kit applying CD45 immunofluorescence combined with a CEP8 fluorescent in-situ hybridization probe for one-step process co-dyeing to identify circulating tumor cells and application thereof. The kit comprises fixing liquid, 2xSSC, 0.3%NP-40 / 0.4xSSC, 0.075M KCI solution, CD45 monoclonal antibody and CEP 8 probe mixed liquid, DAPI counter stain, perforating agent, closing liquid and mounting medium. The CD45 immunofluorescence antibody is combined with the CEP8 fluorescent in-situ hybridization probe to identify captured circulating tumor cells, and immunofluorescence and fluorescent in-situ hybridization detection are completed through a one-step process, so that the problems of mutual interference and long detection time when immunofluorescence detection and fluorescent in-situ hybridization detection are combined are solved; hybridization incubation through the one-step process is completed quickly within 2h, so that detection time is greatly reduced, and detection results are visual to observe.

Description

technical field [0001] The invention belongs to the field of biomedical clinical detection, and particularly relates to a kit for identifying circulating tumor cells by using CD45 immunofluorescence combined with CEP 8 fluorescence in situ hybridization probe and its application. Background technique [0002] Circulating tumor cells (CTCs) refer to the collective name of various tumor cells existing in peripheral blood, which are released from solid tumor lesions (primary tumor, metastases) and released into the peripheral blood circulation due to spontaneous or diagnosis and treatment operations. Cells, most of the CTCs undergo apoptosis or phagocytosis after entering the peripheral blood, and a few can escape and anchor to develop into metastases. In recent years, the clinical performance of CTCs in tumor diagnosis, treatment and monitoring has gradually emerged, and it is currently the most promising method for non-invasive tumor diagnosis and real-time curative effect mo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/533C12Q1/68
CPCC12Q1/6841C12Q1/6888G01N33/533G01N33/56966G01N33/577C12Q2537/143C12Q2563/107
Inventor 叶伦李雪梅李倩程弘夏陈刚
Owner WUHAN HEALTHCHART BIOLOGICAL TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com