Kit for identification of circulating tumor cells through combination of CD45 immunofluorescence and CEP17 probe and use thereof

A tumor cell and immunofluorescence technology, applied in the field of biomedical clinical detection, can solve the problems of difficulty in finding target CTCs, limit the application of FISH technology, etc., and achieve the effect of reducing non-specific hybridization signals, reducing identification errors, and reducing counting errors.

Active Publication Date: 2017-07-25
WUHAN HEALTHCHART BIOLOGICAL TECH
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When fluorescence in situ hybridization technology is applied to the detection of CTCs chromosome polyploidy, gene breakage and gene fusion, due to the presence of a large number of blood cell backgrounds in the captured CTCs, it is extremely difficult to find target CTCs under a fluorescence microscope, which limits the use of FISH technology. Applications in CTCs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for identification of circulating tumor cells through combination of CD45 immunofluorescence and CEP17 probe and use thereof
  • Kit for identification of circulating tumor cells through combination of CD45 immunofluorescence and CEP17 probe and use thereof
  • Kit for identification of circulating tumor cells through combination of CD45 immunofluorescence and CEP17 probe and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP17 fluorescence in situ hybridization probe, the composition of the kit is shown in Table 1 below:

[0042] Table 1 Kit composition

[0043]

Embodiment 2

[0045] Using the kit described in Example 1 to identify circulating tumor cells in breast cancer patients, the CD45 monoclonal antibody + fluorescent in situ hybridization probe for chromosome 17 was used for detection, and the fluorescent in situ hybridization probe specific sequence for chromosome 17 (SEQ ID NO. 1) is: TGAACATTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTGGACCTCCTCTGAGGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATTCTCAGAAACTTCTTGGTGATGTTTGCATTCAAATCCCAGAGT

[0046] Specifically include the following steps:

[0047] (1) Harvest cells: suck the captured circulating tumor cell samples (CTCs) into a conical centrifuge tube, centrifuge at 1000 rpm for 10 min, and remove the supernatant;

[0048] (2) Hypotonicity: Add 6-8 mL of 0.075 mol / L KCL solution pre-warmed to 37°C, blow and mix with a straw, and place in a 37°C incubator for 20-30 minutes;

[0049] (3) Pre-fixation: Add 2 mL of fixative, mix by pipetting, and centrifuge at 1000 rpm for 10 min; ...

Embodiment 3

[0064] Using the kit described in the embodiment of the present invention, CD45 immunofluorescence and CEP17 fluorescence in situ hybridization were used to jointly detect circulating tumor cells in patients with gastric cancer. The specific sequence of chromosome 17 fluorescence in situ hybridization probe (SEQ ID NO.1) is:

[0065] TGAACATTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTGGACCCTCTCTGAGGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATTCTCAGAAACTTCTTGGTGATGTTTGCATTCAAATCCCAGAGT

[0066] Specifically include the following steps:

[0067] (1) Harvesting cells: extract 10ml of peripheral blood from the patient, and use a commercially available circulating tumor cell capture instrument or kit to capture circulating tumor cells (CTCs). The captured circulating tumor cells are sucked into a conical centrifuge tube, centrifuged, and rotated at 1000 / min, 10min, remove the supernatant;

[0068] (2) Hypotonicity: Add 6-8 mL of 0.075mol / L KCL solution pre-warmed t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedical clinical detection and relates to a kit for identification of circulating tumor cells through CD45 immunofluorescence-CEP17 fluorescence in-situ hybridization probe combined one-step method co-dyeing, and a use thereof. The kit comprises a fixing solution, 2*SSC, 0.3% NP-40 / 0.4*SSC, 0.075 M of a KCl solution, a CD45 monoclonal antibody-CEP17 probe mixed liquid, a DAPI redyeing agent, a perforating agent, a sealing liquid and a mounting medium. The kit uses combination of a CD45 immunofluorescent antibody and a CEP17 fluorescence in-situ hybridization probe to identify the captured circulating tumor cells, completes immunofluorescence and fluorescence in-situ hybridization detection by a one-step method, and solves the problem that the immunofluorescence detection and the fluorescence in-situ hybridization detection produce mutual interference in combined use and detection time is long. The one-step method-based hybridization incubation can be fast finished in 2h so that detection time is greatly reduced. The detection result is visual.

Description

technical field [0001] The invention belongs to the field of biomedical clinical detection, and in particular relates to a kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP17 fluorescence in situ hybridization probes and an application thereof. Background technique [0002] Circulating tumor cells (CTCs) refer to all kinds of tumor cells present in peripheral blood, which are released from solid tumor lesions (primary tumors, metastases) and enter peripheral blood circulation due to spontaneous or therapeutic operations. Most CTCs undergo apoptosis or are phagocytized after entering the peripheral blood, and a few can escape and anchor and develop into metastases. In recent years, the clinical performance of CTCs in tumor diagnosis, treatment and monitoring has gradually emerged. It is currently the most promising means of non-invasive tumor diagnosis and real-time efficacy monitoring, and its clinical application value is extremely ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N33/577G01N33/569G01N33/533C12Q1/68
CPCC12Q1/6841C12Q1/6888G01N33/533G01N33/56966G01N33/577C12Q2537/143C12Q2563/107
Inventor叶伦李雪梅李倩程弘夏陈刚
OwnerWUHAN HEALTHCHART BIOLOGICAL TECH