A kit for identifying circulating tumor cells using CD45 immunofluorescence combined with CEP17 probe and its application
A tumor cell and immunofluorescence technology, which is applied in the field of biomedical clinical detection, can solve the problems of finding target CTCs and restricting the application of FISH technology, and achieve the effect of reducing non-specific hybridization signals, reducing identification errors, and reducing counting errors
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] A kit using CD45 immunofluorescence combined with CEP17 fluorescent in situ hybridization probe to identify circulating tumor cells, the composition of the kit is shown in Table 1 below:
[0042] Table 1 Kit composition
[0043]
Embodiment 2
[0045] Using the kit described in Example 1 to identify circulating tumor cells in breast cancer patients, using CD45 monoclonal antibody + chromosome 17 fluorescent in situ hybridization probe detection, chromosome 17 fluorescent in situ hybridization probe specific sequence (SEQ ID NO. 1) is: TGAACATTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTGGACCTCTCTGAGGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATTCTCAGAAACTTCTTGGTGATGTTTGCATTCAAATCCCAGAGT
[0046] Specifically include the following steps:
[0047] (1) Harvest cells: aspirate the captured circulating tumor cell samples (CTCs) into a sharp-bottomed centrifuge tube, centrifuge, 1000 rpm, 10 minutes, and remove the supernatant;
[0048] (2) Hypotonicity: add 6-8mL of 0.075mol / L KCL solution pre-warmed to 37℃, mix well with a pipette, then place in a 37℃ incubator for 20-30min;
[0049] (3) Pre-fixation: add 2 mL of fixative, pipette and mix, centrifuge at 1000 rpm for 10 minutes;
[0050] (4) Aspirate the supernatant, ...
Embodiment 3
[0064] Using the kit described in the embodiment of the present invention, CD45 immunofluorescence and CEP17 fluorescence in situ hybridization are used to detect circulating tumor cells in gastric cancer patients. The specific sequence of the fluorescent in situ hybridization probe of chromosome 17 (SEQ ID NO.1) is:
[0065] TGAACATTCCTTTGGATGGAGCAGGTTTGAGACACTCTTTTTGTACAATCTACAAGTGGATATTTGGACCTCTCTGAGGATTTCGTTGGAAACGGGATAACTGCACCTAACTAAACGGAAGCATTCTCAGAAACTTCTTGGTGATGTTTGCATTCAAATCCCAGAGT
[0066] Specifically include the following steps:
[0067] (1) Harvesting cells: extract 10ml of peripheral blood from the patient, and use a commercially available circulating tumor cell capture instrument or kit to capture circulating tumor cells (CTCs). The captured circulating tumor cells are sucked into a sharp-bottomed centrifuge tube, centrifuged at 1000 rpm / min, 10min, go to the supernatant;
[0068] (2) Hypotonicity: add 6-8mL of 0.075mol / L KCL solution pre-warmed to 37℃, mix well with a...
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



