Internal reference gene for melon fruit genet PCR expression analysis, and stability verification method thereof

[0030] The present invention will be further described in detail below in conjunction with the drawings and specific embodiments:

[0031] The internal reference gene used for PCR expression analysis of muskmelon fruit gene of the present invention is the MELO3C007745T1 gene, and the nucleotide sequence of the internal reference gene is shown in SEQ ID NO: 3.

[0032] The nucleotide sequence of the PCR amplification primer of the MELO3C007745T1 gene is:

[0033] Forward primer sequence: TCTGGAGGAGTAGGTCGGATACC (shown in SEQ ID NO: 1);

[0034] Reverse primer sequence: CGATCAATGACGCAACAAGGCA (shown in SEQ ID NO: 2).

[0035] A method for verifying the stability of the aforementioned internal reference gene, which includes the following steps:

[0036] Step 1: At five sampling time points 15, 20, 25, 30 and 35 days after pollination of Xuelihong melon and flavor 4 melon, three biologically repeated Xuelihong melons and three biological species were selected respectively Learn the repeated flavor No. 4 melon fruit, and select two plants for each biologically repeated Potherb mustard melon. For each biologically repeated flavor 4 melon, two plants are also selected, that is, a total of 30 potherb mustard melon fruits and 30 flavor 4 melon fruits are collected;

[0037] Step 2: Use the plant RNA extraction reagent (Plant RNA Extraction Kit is TaKaRa) to separate the total RNA of the above 30 Potherb mustard melon fruits and 30 Flavor No. 4 melon fruits, and each of the above total RNAs must be satisfied A260/A280 between 1.8 and 2 and A260/A230 between 1.8 and 2 indicate that the total RNA concentration and quality are up to standard (using Nanodrop2000 to detect the concentration and quality of RNA, the ratio of A260/A280 and A260/A230); and each The above-mentioned total RNA needs to pass the integrity test (the integrity of the RNA is detected by 2% agarose gel electrophoresis, and the electrophoresis pattern 28S, 18S has clear bands, indicating that the RNA integrity is good). Reverse transcription reaction to obtain each corresponding cDNA (1uL total RNA using PrimeScript TM RT reagent Kit with gDNA Eraser (TaKaRa) kit first removes genomic DNA, and then reverse transcription (two-step method: 37℃15min; 85℃5s) to form 20μL first-strand cDNA. Reverse transcription is performed on the samples of the two varieties in different treatments, and each copy of the material is repeated, as a backup, stored at -80°C);

[0038] Step 3: Analyze the transcriptome data of the Xueli red melon fruit and the transcriptome data of the flavor 4 melon fruit, and select the following consensus nucleotide sequences from the Xueli red melon fruit transcriptome data and the flavor 4 melon fruit transcriptome data respectively:

[0039] MELO3C026953T1, the nucleotide sequence sees SEQ ID NO: 4, MELO3C002234T2, the nucleotide sequence sees SEQ ID NO: 5, MELO3C007745T1, the nucleotide sequence sees SEQ ID NO: 3, MELO3C008016T1, the nucleotide sequence sees SEQ ID NO: 6, MELO3C009005T1, the nucleotide sequence is shown in SEQ ID NO: 7, MELO3C021785T1, the nucleotide sequence is shown in SEQ ID NO: 8, MELO3C015496T1, the nucleotide sequence is shown in SEQ ID NO: 9, MELO3C013938T1, and the nucleotide sequence is shown in SEQ ID NO: 10. CmRPL and CmRPS15 are used as candidate internal reference genes;

[0040] Among them, CmRPL and CmRPS15 are the sequences reported in references (Kong, Q., et al., Assessment of Suitable Reference Genes for Quan titative Gene Expression Studies in Melon Fruits. Front Plant Sci, 2016.7: p.1178.);