Internal reference gene for melon fruit genet PCR expression analysis, and stability verification method thereof
An internal reference gene and stability technology, applied in the field of plant genetic engineering, can solve the problems of poor stability and poor accuracy of melon gene expression analysis, and achieve the effects of wide application range, wide applicability and high expression stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0030] Below in conjunction with accompanying drawing and specific embodiment the present invention is described in further detail:
[0031] An internal reference gene for PCR expression analysis of muskmelon fruit genes of the present invention, the internal reference gene is the MELO3C007745T1 gene, and the nucleotide sequence of the internal reference gene is shown in SEQ ID NO:3.
[0032] The PCR amplification primer nucleotide sequence of the above-mentioned MELO3C007745T1 gene is:
[0033] Forward primer sequence: TCTGGAGGAGTAGGTCGGATACC (shown in SEQ ID NO: 1);
[0034]Reverse primer sequence: CGATCAATGACGCAACAAGGCA (shown in SEQ ID NO: 2).
[0035] A method for verifying the stability of the above-mentioned internal reference gene, which comprises the following steps:
[0036] Step 1: Select three biological replicates of Xuelihong melon and three biological The flavor No. 4 muskmelon fruit of the biological duplication was selected, and two xuelihong muskmelon plan...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



