Internal reference gene for melon fruit genet PCR expression analysis, and stability verification method thereof

An internal reference gene and stability technology, applied in the field of plant genetic engineering, can solve the problems of poor stability and poor accuracy of melon gene expression analysis, and achieve the effects of wide application range, wide applicability and high expression stability

Inactive Publication Date: 2017-10-03
武汉市农业科学技术研究院作物科学研究所
3 Cites 22 Cited by

AI-Extracted Technical Summary

Problems solved by technology

At present, most of the traditional internal reference genes are used in the gene expression analysis of melon. These traditional internal re...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Abstract

The present invention discloses an internal reference gene for melon fruit genet PCR expression analysis, and a stability verification method for the internal reference gene. According to the present invention, the expression level and the stability of the gene are compared at the whole genome level by using melon transcriptome data so as to select eight stably-expressing genes, two traditional internal reference genes commonly used in melon are selected as controls, the expression stability of the 10 genes in two melon variety fruits at different development stages are compared, and it is determined that the expression stability of the MELO3C007745T1 gene is high highest through verification with genes such as Cmain2 and CmSPS1m, wherein the MELO3C007745T1 gene is the optimal internal reference gene for the real-time fluorescence quantitative PCR analysis in the melon fruit gene expression.

Application Domain

Technology Topic

FluorescencePcr analysis +7

Image

  • Internal reference gene for melon fruit genet PCR expression analysis, and stability verification method thereof
  • Internal reference gene for melon fruit genet PCR expression analysis, and stability verification method thereof
  • Internal reference gene for melon fruit genet PCR expression analysis, and stability verification method thereof

Examples

  • Experimental program(1)
  • Effect test(1)

Example Embodiment

[0030] The present invention will be further described in detail below in conjunction with the drawings and specific embodiments:
[0031] The internal reference gene used for PCR expression analysis of muskmelon fruit gene of the present invention is the MELO3C007745T1 gene, and the nucleotide sequence of the internal reference gene is shown in SEQ ID NO: 3.
[0032] The nucleotide sequence of the PCR amplification primer of the MELO3C007745T1 gene is:
[0033] Forward primer sequence: TCTGGAGGAGTAGGTCGGATACC (shown in SEQ ID NO: 1);
[0034] Reverse primer sequence: CGATCAATGACGCAACAAGGCA (shown in SEQ ID NO: 2).
[0035] A method for verifying the stability of the aforementioned internal reference gene, which includes the following steps:
[0036] Step 1: At five sampling time points 15, 20, 25, 30 and 35 days after pollination of Xuelihong melon and flavor 4 melon, three biologically repeated Xuelihong melons and three biological species were selected respectively Learn the repeated flavor No. 4 melon fruit, and select two plants for each biologically repeated Potherb mustard melon. For each biologically repeated flavor 4 melon, two plants are also selected, that is, a total of 30 potherb mustard melon fruits and 30 flavor 4 melon fruits are collected;
[0037] Step 2: Use the plant RNA extraction reagent (Plant RNA Extraction Kit is TaKaRa) to separate the total RNA of the above 30 Potherb mustard melon fruits and 30 Flavor No. 4 melon fruits, and each of the above total RNAs must be satisfied A260/A280 between 1.8 and 2 and A260/A230 between 1.8 and 2 indicate that the total RNA concentration and quality are up to standard (using Nanodrop2000 to detect the concentration and quality of RNA, the ratio of A260/A280 and A260/A230); and each The above-mentioned total RNA needs to pass the integrity test (the integrity of the RNA is detected by 2% agarose gel electrophoresis, and the electrophoresis pattern 28S, 18S has clear bands, indicating that the RNA integrity is good). Reverse transcription reaction to obtain each corresponding cDNA (1uL total RNA using PrimeScript TM RT reagent Kit with gDNA Eraser (TaKaRa) kit first removes genomic DNA, and then reverse transcription (two-step method: 37℃15min; 85℃5s) to form 20μL first-strand cDNA. Reverse transcription is performed on the samples of the two varieties in different treatments, and each copy of the material is repeated, as a backup, stored at -80°C);
[0038] Step 3: Analyze the transcriptome data of the Xueli red melon fruit and the transcriptome data of the flavor 4 melon fruit, and select the following consensus nucleotide sequences from the Xueli red melon fruit transcriptome data and the flavor 4 melon fruit transcriptome data respectively:
[0039] MELO3C026953T1, the nucleotide sequence sees SEQ ID NO: 4, MELO3C002234T2, the nucleotide sequence sees SEQ ID NO: 5, MELO3C007745T1, the nucleotide sequence sees SEQ ID NO: 3, MELO3C008016T1, the nucleotide sequence sees SEQ ID NO: 6, MELO3C009005T1, the nucleotide sequence is shown in SEQ ID NO: 7, MELO3C021785T1, the nucleotide sequence is shown in SEQ ID NO: 8, MELO3C015496T1, the nucleotide sequence is shown in SEQ ID NO: 9, MELO3C013938T1, and the nucleotide sequence is shown in SEQ ID NO: 10. CmRPL and CmRPS15 are used as candidate internal reference genes;
[0040] Among them, CmRPL and CmRPS15 are the sequences reported in references (Kong, Q., et al., Assessment of Suitable Reference Genes for Quan titative Gene Expression Studies in Melon Fruits. Front Plant Sci, 2016.7: p.1178.);
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

no PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Similar technology patents

Nano talcpowder modified polypropylene composite material and preparation method thereof

ActiveCN102532685AHigh rigidity and toughnessWide range of applicationsMicron scalePolypropylene composites
Owner:SHANGHAI PRET COMPOSITES

Classification and recommendation of technical efficacy words

Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products