Method for rapid detection of components of Iphigenia indica and Fritillaria maximowiczii
A technology of Fritillaria verticillum and Fritillaria verticillium, applied in the direction of biochemical equipment and methods, microbe determination/inspection, etc., to achieve the effects of promoting the modernization of traditional Chinese medicine, strengthening management, good sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] 1. Primers and probes used:
[0038] Use the GenBank database (https: / / www.ncbi.nlm.nih.gov / genbank / ) to find the rbcL gene of Iphigenia indica and the ITS2 gene of Fritillaria maximowiczii, and their GenBank Accession numbers are respectively For AJ417893 and KP712000.1, design and synthesize real-time fluorescent PCR specific amplification primers and probes.
[0039] The primers and probes for real-time fluorescent PCR detection of Fritillaria fritillaria-derived components are:
[0040] Upstream primer P1: CCAGTCTTGATCGTTACAAAGG
[0041] Downstream primer P2: GAACCTTCTTCAAAAAGGTCTAAAGG
[0042] The sequence of the probe with fluorescent dye is: AGCATCGAGAAAGTTATTGGGGAAGAAAATCA
[0043] The fluorescent dyes are labeled with FAM at the 5' end and TAMRA at the 3' end.
[0044] The primer probes for real-time fluorescent PCR detection of Fritillaria verticillium components are:
[0045] Upstream primer P1: CTACTCGGGACCTCGCAAT
[0046] Downstream primer P2: CACCGCA...
Embodiment 2
[0075] 1. Primers and probes used:
[0076] The rbcl genes of Fritillaria fritillaria and Fritillaria verticillum were selected as objects, and specific amplification primers and probes for real-time fluorescent PCR were designed and synthesized.
[0077] The primers and probes for real-time fluorescent PCR detection of Fritillaria fritillaria-derived components are:
[0078] Upstream primer P1: CCAGTCTTGATCGTTACAAAGG
[0079] Downstream primer P2: GAACCTTCTTCAAAAAGGTCTAAAGG
[0080] The sequence of the probe with fluorescent dye is: AGCATCGAGAAAGTTATTGGGGAAGAAAATCA
[0081] The fluorescent dyes are labeled with FAM at the 5' end and TAMRA at the 3' end.
[0082] The primer probes for real-time fluorescent PCR detection of Fritillaria verticillium components are:
[0083] Upstream primer P1: CTACTCGGGACCTCGCAAT
[0084] Downstream primer P2: CACCGCAGAGGCATCGAC
[0085] The sequence of the probe with fluorescent dye is: TCCTCGGACACTATTT.
[0086] The fluorescent dyes are...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



