Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene related to eclipta prostrate drug resistance and application thereof

A drug resistance and gene technology, applied in the field of molecular biology, can solve the problems of inability to detect in season, heavy workload, and large land occupation, and achieve the effect of rapid diagnosis, strong practicability, good specificity and sensitivity

Active Publication Date: 2017-12-08
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method can objectively evaluate the resistance of a certain weed to the corresponding herbicide, but it also has its limitations, mainly in the following two aspects: one is that it cannot be tested in the same season and at that time, and the other is that it takes up a lot of land and time long, heavy workload
So far, there is no report on the correlation between the resistance to ALS inhibitor herbicides and the mutation site in the conserved region of ALS

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene related to eclipta prostrate drug resistance and application thereof
  • Gene related to eclipta prostrate drug resistance and application thereof
  • Gene related to eclipta prostrate drug resistance and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1 Cloning of the ALS gene in the snakehead intestine

[0067] On the NCBI website, search for Compositae plants (Helianthus annuus, accession number AY541454.1), cocklebur (Xanthium sibiricum, accession number U16280.1), Conyza canadensis (accession number HM067014. 1) and the ALS gene of stinky chamomile (Anthemis cotula, accession number JF327754.1) were used as reference sequences, and the ALS gene of Arabidopsis thaliana (accession number AY042819.1) was used for sequence comparison. According to the principles of primer design, the first set of primers was designed using DNA MAN6.0 software, as shown in Table 1.

[0068] Table 1 Primers for amplifying the ALS gene of snakehead intestine (the first group)

[0069] direction

Numbering

sequence 5'-3'

F

143

CACCACCAAACCACCCTCTC

R

1012

AGCTCCACAAACCGCCTC

F

143

CACCACCAAACCACCCTCTC

R

1594

AACCCAAAACCCATCGCC

F

143

CACCACCAAACCACCCTC...

Embodiment 2

[0119] Example 2 Design of PCR primers for detection of ALS inhibitor herbicide-resistant snakehead intestines

[0120] According to the full-length sequence of the ALS gene of the channa and the principles of primer design, 2 pairs of primers were designed using DNA MAN6.0 software to amplify the full-length ALS gene of the channa, as shown in Table 9.

[0121] Table 9 Amplifies the primers of the ALS gene of the snakehead intestine

[0122]

[0123]

[0124] The PCR amplification system (15 μl) and the reaction conditions are the same as the first group of PCR. Take 3 μl of the PCR reaction solution and use 1% Agarose gel electrophoresis, the temperature gradient amplification result of the primer pair is as follows: Figure 9 , 10 As shown, the amplification effect is good, and the sequencing results show that the ALS gene sequence of the snakehead intestine, the fragment covers A122, P197, A205, D376, R377, W574, S653 and G654 eight SNP sites related to drug resista...

Embodiment 3

[0125] Example 3 PCR detection method for the herbicide-resistant ALS inhibitor herbicides

[0126] Experimental materials: Channa sausages collected from different regions.

[0127] Experimental methods: ①Preparation of DNA from Channa sausiata Take 200 mg of fresh leaves of Channa sausiata, grind them with liquid nitrogen, and extract DNA from the leaves of Channa saegosa by conventional CTAB method.

[0128] ② Specific primers used to detect the LC-ALS mutation site in the snakehead intestine, the primer sequences are shown in Table 9 in Example 2.

[0129] ③ For the PCR reaction system used to detect the ALS mutation site in the snakehead intestine, see the PCR of the first group in Example 1.

[0130] ④ For the PCR amplification procedure used to detect the ALS mutation site in the snakehead intestine, see the PCR of the first group in Example 1, primer pair I, and primer pair II.

[0131] ⑤Identification of PCR products Take 3 μL of PCR products, separate them by 1% (w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular marker related to eclipta prostrate drug resistance and application thereof, and the molecular marker is CCC-TCC base mutation of codon, encoded by LC-ALS gene shown in amino acid sequence such as SEQ ID NO.1, of the 176th amino acid of the amino acid sequence shown in SEQ ID NO.2. The invention further provides specific primers and a method for detecting the molecular marker, sequence of the specific primer pair is as shown in SEQ ID NO. 3-4 and SEQ ID NO. 5-6, field suspected anti-ALS inhibitor eclipta prostrate can be rapid identificated and mutation sites can be confirmed by adopting the primer pair, so that scientific management for resistance eclipta prostrate can be guided in production practice, and the molecular marker related to eclipta prostrate drug resistance has good specificity and sensitivity; and the method is accurate and reliable, and operation is easy.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a gene LC-ALS related to the drug resistance of the snakehead intestine, a SNP molecular marker related to the drug resistance of the snakehead intestine, and a method for detecting the LC-ALS gene. Background technique [0002] Acetolactate synthase (ALS for short), also known as acetohydroxyacid synthase (AHAS for short), is a biosynthetic process that induces valine, leucine, and isoleucine in plants and microorganisms. A key enzyme and an important herbicide target. The development and use of ALS inhibitor herbicides began in the early 1980s. Due to the obvious advantages of such herbicides, such as super high activity, low toxicity to humans and animals, and environmental friendliness, they have attracted widespread attention. At present, 50 Multiple varieties were developed and used. Since the 1980s, my country has successively promoted the use of metsulfuron-me...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/60C12N9/88C12Q1/68C12N15/11
CPCC12N9/88C12Q1/6895C12Q2600/13C12Q2600/156C12Y401/03
Inventor 崔海兰李丹李香菊于惠林张宏军
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI