Schisandra chinensis molecular identity card and identification method
A molecular ID card and identification method technology, applied in the field of identification of Chinese medicinal materials source varieties, can solve the problems of large differences in chemical composition and content, and achieve the effect of accurate identification and wide applicability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1 is used to illustrate the identification method of Schisandra medicinal material
[0028] 1) A total of 47 parts of Schisandra chinensis were collected from Beijing, Jiangsu, Shaanxi, Shanxi, Jilin and other provinces and cities, as well as Bozhou in Anhui, Anguo in Hebei, and Hehuachi in Sichuan. Take 80 mg of the medicinal materials respectively and grind them in the MM 400 ball mill ( Retsch, Germany) was used for grinding, and the total DNA was extracted with the plant genomic DNA kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.
[0029] Table 1 Schisandra sample information table
[0030]
[0031]
[0032] 2) PCR amplification
[0033] The primer sequence is ITS2F: ATGCGATACTTGGTGTGAAT; WWZ5R: GCTCCTCGCAAACACCATAC, synthesized by Sangon Bioengineering Co., Ltd. (Beijing DNA Synthesis Department). Primers were dissolved in sterile deionized water and diluted to 2.5 μmol / μL.
[0034] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ ...
Embodiment 2 5
[0044] The identification of embodiment 2 Schisandra chinensis original plant
[0045] The same method as in Example 1 was used for identification, except that the original plant of Schisandra chinensis was used as the sample. One sample of the original plant was collected from Dongling Mountain in Beijing, and DNA was extracted for identification. The results can also specifically detect Schisandra molecular ID.
Embodiment 3 5
[0046] Identification of embodiment 3 Schisandra Chinese patent medicine
[0047] The same method as in Example 1 was used for identification, except that the Chinese patent medicine containing Schisandra chinensis was used as a sample. Two copies of Chinese patent medicine containing Schisandra chinensis were purchased from pharmacies in Beijing, and DNA was extracted for identification. The results can also specifically detect the molecular identity card of Schisandra chinensis, which can realize the identification of Chinese patent medicines containing Schisandra chinensis.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap