Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Schisandra chinensis molecular identity card and identification method

A molecular ID card and identification method technology, applied in the field of identification of Chinese medicinal materials source varieties, can solve the problems of large differences in chemical composition and content, and achieve the effect of accurate identification and wide applicability

Inactive Publication Date: 2018-01-23
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, in modern research, the chemical composition and content of the fruits of Zhongnan and North Schisandra are very different, and the price of Zhongnan Schisandra in the market is relatively cheap, and it is often used as Schisandra.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Schisandra chinensis molecular identity card and identification method
  • Schisandra chinensis molecular identity card and identification method
  • Schisandra chinensis molecular identity card and identification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1 is used to illustrate the identification method of Schisandra medicinal material

[0028] 1) A total of 47 parts of Schisandra chinensis were collected from Beijing, Jiangsu, Shaanxi, Shanxi, Jilin and other provinces and cities, as well as Bozhou in Anhui, Anguo in Hebei, and Hehuachi in Sichuan. Take 80 mg of the medicinal materials respectively and grind them in the MM 400 ball mill ( Retsch, Germany) was used for grinding, and the total DNA was extracted with the plant genomic DNA kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0029] Table 1 Schisandra sample information table

[0030]

[0031]

[0032] 2) PCR amplification

[0033] The primer sequence is ITS2F: ATGCGATACTTGGTGTGAAT; WWZ5R: GCTCCTCGCAAACACCATAC, synthesized by Sangon Bioengineering Co., Ltd. (Beijing DNA Synthesis Department). Primers were dissolved in sterile deionized water and diluted to 2.5 μmol / μL.

[0034] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ ...

Embodiment 2 5

[0044] The identification of embodiment 2 Schisandra chinensis original plant

[0045] The same method as in Example 1 was used for identification, except that the original plant of Schisandra chinensis was used as the sample. One sample of the original plant was collected from Dongling Mountain in Beijing, and DNA was extracted for identification. The results can also specifically detect Schisandra molecular ID.

Embodiment 3 5

[0046] Identification of embodiment 3 Schisandra Chinese patent medicine

[0047] The same method as in Example 1 was used for identification, except that the Chinese patent medicine containing Schisandra chinensis was used as a sample. Two copies of Chinese patent medicine containing Schisandra chinensis were purchased from pharmacies in Beijing, and DNA was extracted for identification. The results can also specifically detect the molecular identity card of Schisandra chinensis, which can realize the identification of Chinese patent medicines containing Schisandra chinensis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a schisandra chinensis molecular identity which contains a nucleotide sequence as shown in SEQ ID No.1. The molecular identity card and the method provided by the method can be used for accurately separating schisandra chinensis from kadsura longepedunculata. The method provided by the invention is wider in applicability, and can detect all samples, in which DNA can be extracted. Therefore, the schisandra chinensis molecular identity can realize quick and accurate identification for schisandra chinensis plant, medicinal materials, seeds, seedlings, powder and schisandra chinensis-containing Chinese patent medicines.

Description

technical field [0001] The invention belongs to the technical field of identification of source varieties of Chinese medicinal materials, and in particular relates to a Schisandra molecular ID card and an identification method. Background technique [0002] Schisandra chinensis (Turcz.) Baill. is the dried and mature fruit of Magnolia plant Schisandra chinensis (Turcz.) Baill. Schisandra sphenanthera Rehd.et Wils. is the dry and mature fruit of Schisandra sphenanthera Rehd.et Wils., which is similar in shape to Schisandra chinensis. Li Shizhen's "Compendium of Materia Medica" said: "Schisandra is now divided into north and south. Those produced in the south are red in color, and those produced in the north are black in color. Human nourishing medicine must use the one produced in the north to be good." At the same time, the chemical composition and content of the fruits of the southern and northern Schisandra are very different in modern research, and the price of the south...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
Inventor 庞晓慧任莉郭梦月宋经元陈士林
Owner INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com