Bispecific antibody as well as preparation method and application thereof
A bispecific antibody, antibody technology, applied in the field of immunity, can solve the problems of small molecular weight and poor stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0093] The GPC3-CD16A bispecific antibody was prepared as follows, and is sometimes referred to as the GPC3-CD16A bispecific antibody hereinafter.
[0094] A. Amplify the nucleotide sequence encoding the heavy chain constant region of the antibody, the nucleotide sequence encoding the antibody corresponding to GPC3, and the nucleotide sequence encoding the antibody corresponding to CD16a according to the primers, wherein the encoding GPC3 is the surface antigen of liver cancer cells, encoding CD16a is an antigen on the surface of NK cells.
[0095] Nucleotide sequence encoding heavy chain constant region:
[0096] ggccagccgcgcgaaccgcaggtgtataccctgccgccgagccgcgaagaaatgaccaaaaaccaggtgagcctgacctgcctggtgaaaggcttttatccgagcgatattgcggtggaatgggaaagcaacggccagccggaaaacaactataaaaccaccccgccggtgctggatagcgatggcagcttttttctgtatagcaaactgaccgtggataaaagccgctggcagcagggcaacgtgtttagctgcagcgtgatgcatgaagcgctgcataaccattatacccagaaaagcctgagcctgagcccgggcaaa(SEQ ID NO:16)
[0097] Nucleotide sequence enc...
Embodiment 2
[0147] The nucleotide sequence encoding the constant region of the heavy chain and the nucleotide sequence encoding the antibody corresponding to GPC3 are the same as those in Example 1. The operation of Embodiment 2 is the same as that of Embodiment 1 except for the following.
[0148] Nucleotide sequence encoding CD3 corresponding antibody:
[0149] gatattcagatgacccagagcccgagcagcctgagcgcgagcgtgggcgatcgcgtgaccattacctgcagcgcgagcagcagcgtgagctatatgaactggtatcagcagaccccgggcaaagcgccgaaacgctggatttatgataccagcaaactggcgagcggcgtgccgagccgctttagcggcagcggcagcggcaccgattatacctttaccattagcagcctgcagccggaagatattgcgacctattattgccagcagtggagcagcaacccgtttacctttggccagggcaccaaactgcagattacccgcgcgggcggcggcggcagccaggtgcagctggtgcagagcggcggcggcgtggtgcagccgggccgcagcctgcgcctgagctgcaaagcgagcggctatacctttacccgctataccatgcattgggtgcgccaggcgccgggcaaaggcctggaatggattggctatattaacccgagccgcggctataccaactataaccagaaagtgaaagatcgctttaccattagccgcgataacagcaaaaacaccgcgtttctgcagatggatagcctgcgcccggaagataccggcgtgtatttttgcgcgcgctatta...
experiment Embodiment 1
[0169] Experimental example 1 Bispecific antibody configuration analysis
[0170] The configuration analysis of the bispecific antibodies prepared in Examples 1 and 2 was carried out as follows.
[0171] Take 80 μL of bispecific antibody, add 20 μL of 5x loading buffer, mix well, boil at 100°C for 10 min, and serve as denaturing group.
[0172] Take another 80 μL of bispecific antibody, add 20 μL of 5x loading buffer, mix well, and leave it untreated as the non-denaturing group.
[0173] The two groups of samples were run on 10% SDS-PAGE gel to detect the bispecific antibody configuration. The specific steps are as follows:
[0174] 1. Preparation of separating gel and stacking gel: prepare 10% separating gel and 5% stacking gel in the order and ratio of the solutions in the table below. After adding the liquids in the table and mixing them evenly to prepare the separating gel, slowly drop the gel liquid along the inner surface of the long glass plate of the gel cavity with ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com