Bispecific antibody as well as preparation method and application thereof

A bispecific antibody, antibody technology, applied in the field of immunity, can solve the problems of small molecular weight and poor stability

Inactive Publication Date: 2018-08-10
广州市拜沃思生物科技有限公司
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the common bispecific antibody configuration is mainly based on simply connecting two single-chain antibody fragments (scFv) in series. This configuration has a small molecular weight and is easy to reach the tumor microenvironment. Region (also known as Fc (Fragment crystallizable) segment), poor stability

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bispecific antibody as well as preparation method and application thereof
  • Bispecific antibody as well as preparation method and application thereof
  • Bispecific antibody as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] The GPC3-CD16A bispecific antibody was prepared as follows, and is sometimes referred to as the GPC3-CD16A bispecific antibody hereinafter.

[0094] A. Amplify the nucleotide sequence encoding the heavy chain constant region of the antibody, the nucleotide sequence encoding the antibody corresponding to GPC3, and the nucleotide sequence encoding the antibody corresponding to CD16a according to the primers, wherein the encoding GPC3 is the surface antigen of liver cancer cells, encoding CD16a is an antigen on the surface of NK cells.

[0095] Nucleotide sequence encoding heavy chain constant region:

[0096] ggccagccgcgcgaaccgcaggtgtataccctgccgccgagccgcgaagaaatgaccaaaaaccaggtgagcctgacctgcctggtgaaaggcttttatccgagcgatattgcggtggaatgggaaagcaacggccagccggaaaacaactataaaaccaccccgccggtgctggatagcgatggcagcttttttctgtatagcaaactgaccgtggataaaagccgctggcagcagggcaacgtgtttagctgcagcgtgatgcatgaagcgctgcataaccattatacccagaaaagcctgagcctgagcccgggcaaa(SEQ ID NO:16)

[0097] Nucleotide sequence enc...

Embodiment 2

[0147] The nucleotide sequence encoding the constant region of the heavy chain and the nucleotide sequence encoding the antibody corresponding to GPC3 are the same as those in Example 1. The operation of Embodiment 2 is the same as that of Embodiment 1 except for the following.

[0148] Nucleotide sequence encoding CD3 corresponding antibody:

[0149] gatattcagatgacccagagcccgagcagcctgagcgcgagcgtgggcgatcgcgtgaccattacctgcagcgcgagcagcagcgtgagctatatgaactggtatcagcagaccccgggcaaagcgccgaaacgctggatttatgataccagcaaactggcgagcggcgtgccgagccgctttagcggcagcggcagcggcaccgattatacctttaccattagcagcctgcagccggaagatattgcgacctattattgccagcagtggagcagcaacccgtttacctttggccagggcaccaaactgcagattacccgcgcgggcggcggcggcagccaggtgcagctggtgcagagcggcggcggcgtggtgcagccgggccgcagcctgcgcctgagctgcaaagcgagcggctatacctttacccgctataccatgcattgggtgcgccaggcgccgggcaaaggcctggaatggattggctatattaacccgagccgcggctataccaactataaccagaaagtgaaagatcgctttaccattagccgcgataacagcaaaaacaccgcgtttctgcagatggatagcctgcgcccggaagataccggcgtgtatttttgcgcgcgctatta...

experiment Embodiment 1

[0169] Experimental example 1 Bispecific antibody configuration analysis

[0170] The configuration analysis of the bispecific antibodies prepared in Examples 1 and 2 was carried out as follows.

[0171] Take 80 μL of bispecific antibody, add 20 μL of 5x loading buffer, mix well, boil at 100°C for 10 min, and serve as denaturing group.

[0172] Take another 80 μL of bispecific antibody, add 20 μL of 5x loading buffer, mix well, and leave it untreated as the non-denaturing group.

[0173] The two groups of samples were run on 10% SDS-PAGE gel to detect the bispecific antibody configuration. The specific steps are as follows:

[0174] 1. Preparation of separating gel and stacking gel: prepare 10% separating gel and 5% stacking gel in the order and ratio of the solutions in the table below. After adding the liquids in the table and mixing them evenly to prepare the separating gel, slowly drop the gel liquid along the inner surface of the long glass plate of the gel cavity with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a bispecific antibody as well as a preparation method and application thereof. The bispecific antibody comprises the following components from a N terminal to a C terminal: a liver cancer cell surface antigen GPC3 corresponding antibody; a heavy chain constant region; and an immune cell surface antigen corresponding antibody. The bispecific antibody disclosed by the invention can simultaneously recognize a liver cancer cell surface antigen and an immune cell surface antigen, and realizes targeted killing of liver cancer cells by immune cells; at the same time, the bispecific antibody is used as a bridge to connect the immune cells and the liver cancer cells, can increase contact time of the immune cells and the liver cancer cells, and effectively enhance a killing effect of the immune cells on the liver cancer cells; and since the two antigens are combined at the same time, the bispecific antibody disclosed by the invention can effectively activate the immune cells, close the distance between the immune cells and the liver cancer cells, increase an effector-target ratio, and enhance tumoricidal ability of the immune cells.

Description

technical field [0001] The invention relates to the field of immunity, in particular to a bispecific antibody and its preparation method and application. Background technique [0002] Bispecific antibody (bispecific antibody, BsAb) is an artificial antibody containing two specific antigen-binding sites, which can build a bridge between target cells and functional molecules (cells), and produce oriented effector functions. has broad application prospects. [0003] Liver cancer is a malignant tumor that occurs in the liver and has a high mortality rate. It is divided into two categories: primary and secondary. The current treatment methods include surgery and radiation therapy. [0004] How to provide a bispecific antibody for treating liver cancer is of great significance for the treatment of liver cancer. [0005] At present, the common bispecific antibody configuration is mainly based on simply connecting two single-chain antibody fragments (scFv) in series. This configur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K16/46C12N15/13C12N15/85C12N5/10A61K39/395A61K9/19A61P35/00
CPCA61K9/0019A61K9/19A61K2039/505C07K16/2809C07K16/283C07K16/30C07K2317/31C07K2317/622C07K2317/92C12N15/85
Inventor 孙瑞霞
Owner 广州市拜沃思生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap