Supercharge Your Innovation With Domain-Expert AI Agents!

Method for cultivating rice blast-resistant two-line sterile rice line

A technology for rice blast resistance and rice blast resistance gene is applied in the field of cultivating rice blast-resistant two-line sterile lines, which can solve the problems of lack of rice blast-resistant varieties, and achieve high accuracy, excellent quality, and coordination of quality and yield. Effect

Active Publication Date: 2018-09-07
INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to overcome the problem of the lack of blast-resistant varieties in rice production in the prior art, and provide a method for cultivating rice blast-resistant two-line sterile lines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cultivating rice blast-resistant two-line sterile rice line
  • Method for cultivating rice blast-resistant two-line sterile rice line
  • Method for cultivating rice blast-resistant two-line sterile rice line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] A method for cultivating a rice blast-resistant two-line sterile line, which is carried out in accordance with the following steps:

[0051] 1. Using the rice photothermosensitive genic male sterile line Guangzhan 63-4S as the female parent and GD-7 with blast resistance genes Pi1 and Pi2 as the male parent, the two were crossed in Wuhan in the first summer to obtain F 1 seeds, and planted F in Hainan in the winter of the same year 1 After the seed was backcrossed with Guangzhan 63-4S in the second spring to obtain BC 1 f 1 seed;

[0052] 2. Plant BC in Wuhan in the summer of the second year 1 f 1 Seed to get BC 1 f 1 groups, then in BC 1 f 1 Fertile individual plants with Pi1 and Pi2 gene markers were backcrossed with Guangzhan 63-4S to obtain BC by molecular marker-assisted selection in the population 2 f 1 Seeds, wherein, in the molecular marker-assisted selection process, the primers for the molecular detection of the gene Pi1 are F:ATTGCTGCAAAGTGGGAGAC, R...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for cultivating a rice blast-resistant two-line sterile rice line is characterized in that the rice blast-resistant two-line sterile rice line fusing rice blast-resistant genes Pi1 and Pi2 iscultivated through using a rice photo-thermo-sensitive genic male sterile line Guangzhan 63-4S as a female parent, using GD-7 with the rice blast-resistant genes Pi1 and Pi2 as a male parent, selecting the rice blast-resistant gene through molecular marker assisting in generation separation, performing fertility identification on medium to high generations by adopting artificial cold water pool treatment and performing field agronomic property investigation. The method improves the combining ability of the sterile line, facilitates the utilization of indica and japonica hybrid, ensures the high accuracy and the high reliability of a selection result, and overcomes the contradiction among the resistance, the variety and the yield.

Description

technical field [0001] The invention belongs to the technical field of plant breeding, and in particular relates to a method for cultivating rice blast-resistant two-line sterile lines. Background technique [0002] Rice blast is one of the three major diseases of rice, which can cause a substantial reduction in rice production, in severe cases, by 40% to 50%, or even failure. Rice blast occurs to varying degrees in all major rice regions in my country, and the occurrence has gradually shown an upward trend in recent years. Breeding and popularizing rice blast resistant rice varieties is the most economical and effective way to control rice blast. [0003] Hybrid rice is one of the main types of rice varieties widely used in current production, but there is a certain contradiction between the rice blast resistance, yield and quality of rice varieties, and the varieties with good disease resistance often have low yield and poor quality , or varieties with good quality have ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01H1/02A01H1/04
CPCA01H1/02A01H1/04
Inventor 査中萍夏明元戚华雄李进波万丙良杜雪树殷得所
Owner INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com