CD22 three-generation chimeric antigen receptor real-time fluorescent quantitative PCR detection method and kit
A real-time fluorescence quantitative, chimeric antigen receptor technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., to achieve the effect of less personal toxicity, accurate and rapid effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] CD22 third-generation chimeric antigen receptor real-time fluorescent quantitative PCR detection method, the method comprising:
[0030] The first step: extract the DNA of the sample to be tested;
[0031] The second step: PCR reaction: take specific amplification primers, PCR buffer, deoxynucleoside triphosphate mixture, DNA dye and DNA polymerase, add the sample DNA to be tested to make a PCR reaction solution;
[0032] The third step: carry out PCR amplification reaction, and measure the absorbance value at the end of each cycle;
[0033] Wherein, the specific amplification primer described in the second step is as follows:
[0034] The upstream primer (SEQ ID NO.1) is: 5'AGAGGGGAGCGCAAACTGA 3'; the downstream primer (SEQ ID NO.2) is 5'GGAATCTAAGATTGACTTAATT 3';
[0035] The composition of the PCR reaction solution is as follows (according to the final concentration): 10 μL of 10× amplification buffer; 200 μmol / L each of dATP, dTTP, dCTP, and dGTP; 20 pmol of upstr...
Embodiment 2
[0040] CD22 third-generation chimeric antigen receptor real-time fluorescent quantitative PCR detection method, the method comprising:
[0041] The first step: extract the DNA of the sample to be tested;
[0042] The second step: PCR reaction: take specific amplification primers, PCR buffer, deoxynucleoside triphosphate mixture, DNA dye and DNA polymerase, add the sample DNA to be tested to make a PCR reaction solution;
[0043] The third step: carry out PCR amplification reaction, and measure the absorbance value at the end of each cycle;
[0044] The specific amplification primers described in the second step are as follows:
[0045]The upstream primer is SEQ ID NO.1: 5'AGGACGGAGCGCAAACTGA3'; the downstream primer is SEQ ID NO.2: 5'GGTATCTAAGATTGACTCTATT 3'.
[0046] The final concentration of each component in the PCR reaction solution is as follows: 10 μL of 10× amplification buffer; 200 μmol / L each of dATP, dTTP, dCTP, and dGTP; 25 pmol each of upstream and downstream s...
Embodiment 3
[0050] CD22 third-generation chimeric antigen receptor real-time fluorescent quantitative PCR detection method, the method comprising:
[0051] The first step: extract the DNA of the sample to be tested;
[0052] The second step: PCR reaction: take specific amplification primers, PCR buffer, deoxynucleoside triphosphate mixture, DNA dye and DNA polymerase, add the sample DNA to be tested to make a PCR reaction solution;
[0053] The third step: carry out PCR amplification reaction, and measure the absorbance value at the end of each cycle;
[0054] The specific amplification primers described in the second step are as follows:
[0055] The upstream primer is SEQ ID NO.1: 5'AGGACGGAGCGCAAACTGA3'; the downstream primer is SEQ ID NO.2: 5'GGTATCTAAGATTGACTCTATT 3'.
[0056] The final concentration of each component in the PCR reaction solution is as follows: 10 × amplification buffer 10 μL; dATP, dTTP, dCTP, dGTP each 200 μmol / L; specific primer upstream and downstream each 30pm...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More