A screening kit for metastatic screening of papillary thyroid microcarcinoma
A technology for papillary carcinoma and thyroid gland, which is applied in the detection field of papillary thyroid microcarcinoma, can solve the problems of lack of transcriptomics, etc., and achieve the effect of avoiding overtreatment, reducing economic burden, and rational utilization
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 The relationship between the expression level of Trpc5 and the status of papillary thyroid microcarcinoma
[0021] 1. Pathology Collection
[0022] Collected PTMC cases from December 2016 to May 2018 in West China Hospital of Sichuan University, and signed informed consent for specimen collection before operation. Those who met the above conditions were routinely collected surgically resected pathological tissue samples. Within 15 minutes after excising the glandular lobe where the cancer focus is located, the cancer focus and normal tissue are collected and filled with liquid nitrogen, and the patient’s information is registered in detail to make a record. After a few months, a pathological test is performed to determine whether there is high lymph node metastasis or no metastasis. Strictly select and include The expression level of Trpc5 was detected in the tumor tissues of the non-metastasis and high-metastasis groups, 35 cases without metastases and 26 cas...
Embodiment 2
[0046] Embodiment 2 Composition and method of use of the kit for detecting Trpc5 of the present invention
[0047] 1. PCR detection kit
[0048] 1. The composition of the kit
[0049] Detection kit (50 copies):
[0050] components volume upstream primer 0.5ul (10μM) downstream primer 0.5ul (10μM) 2×PCR Enzyme Mix 10 μL dd water to a total volume of 20 μL
[0051] Trpc5 primer sequence is as follows:
[0052] Forward: TCCTGTTTCCCATGCTGTCT
[0053] Reverse: GCCCCTGTACATGAAGGTCT.
[0054] 2. How to use the kit
[0055] Take out the tissue stored in liquid nitrogen, place it on ice for 5 minutes to soften it, pulverize it with a tissue homogenizer, weigh it, and add 1ml TRIZOL per 100mg tissue. Add 0.2ml of chloroform to every 1ml of TRIZOL reagent lysed sample, and cap the tube tightly. Shake the tube vigorously by hand for 15 seconds, and incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at 12000 rpm for 15 minutes at 4°C. ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap