Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A screening kit for metastatic screening of papillary thyroid microcarcinoma

A technology for papillary carcinoma and thyroid gland, which is applied in the detection field of papillary thyroid microcarcinoma, can solve the problems of lack of transcriptomics, etc., and achieve the effect of avoiding overtreatment, reducing economic burden, and rational utilization

Active Publication Date: 2021-01-01
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are no transcriptomic studies and literature reports related to papillary thyroid carcinoma (PTC) and papillary thyroid microcarcinoma (PTMC) (tumor diameter ≤ 1cm)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A screening kit for metastatic screening of papillary thyroid microcarcinoma

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 The relationship between the expression level of Trpc5 and the status of papillary thyroid microcarcinoma

[0021] 1. Pathology Collection

[0022] Collected PTMC cases from December 2016 to May 2018 in West China Hospital of Sichuan University, and signed informed consent for specimen collection before operation. Those who met the above conditions were routinely collected surgically resected pathological tissue samples. Within 15 minutes after excising the glandular lobe where the cancer focus is located, the cancer focus and normal tissue are collected and filled with liquid nitrogen, and the patient’s information is registered in detail to make a record. After a few months, a pathological test is performed to determine whether there is high lymph node metastasis or no metastasis. Strictly select and include The expression level of Trpc5 was detected in the tumor tissues of the non-metastasis and high-metastasis groups, 35 cases without metastases and 26 cas...

Embodiment 2

[0046] Embodiment 2 Composition and method of use of the kit for detecting Trpc5 of the present invention

[0047] 1. PCR detection kit

[0048] 1. The composition of the kit

[0049] Detection kit (50 copies):

[0050] components volume upstream primer 0.5ul (10μM) downstream primer 0.5ul (10μM) 2×PCR Enzyme Mix 10 μL dd water to a total volume of 20 μL

[0051] Trpc5 primer sequence is as follows:

[0052] Forward: TCCTGTTTCCCATGCTGTCT

[0053] Reverse: GCCCCTGTACATGAAGGTCT.

[0054] 2. How to use the kit

[0055] Take out the tissue stored in liquid nitrogen, place it on ice for 5 minutes to soften it, pulverize it with a tissue homogenizer, weigh it, and add 1ml TRIZOL per 100mg tissue. Add 0.2ml of chloroform to every 1ml of TRIZOL reagent lysed sample, and cap the tube tightly. Shake the tube vigorously by hand for 15 seconds, and incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at 12000 rpm for 15 minutes at 4°C. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a screening kit for metastatic screening of papillary thyroid micro carcinoma and use thereof. The screening kit effectively determines whether or not a detection object suffers from metastatic papillary thyroid micro carcinoma, the patient of which the test result is positive is suggested with early surgery, and the patient of which the test result is negative can continueto be observed, so that excessive treatment and insufficient treatment of the papillary thyroid micro carcinoma are avoided, and the clinical application prospect is excellent.

Description

technical field [0001] The invention relates to a detection method for thyroid micropapillary carcinoma. Background technique [0002] The incidence of thyroid cancer is increasing rapidly around the world, and it is the solid malignant tumor with the fastest annual growth rate. It is estimated that by 2019, thyroid cancer will become the third most common malignant tumor in women. Most of these new cases are papillary thyroid microcarcinoma (PTMC), which is papillary thyroid cancer with tumor diameter ≤1cm. Depending on the country, PTMCs account for between 40% and 50% of new thyroid cancers. At present, whether there is overdiagnosis and treatment of patients with papillary thyroid microcarcinoma is one of the hottest and most controversial topics in thyroid surgery. However, there is no way to accurately judge the aggressiveness and prognosis of PTMC before surgery, and It is impossible to predict in advance which PTMCs will cause greater harm to patients and need time...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886G01N33/574
CPCC12Q1/6886C12Q2600/118C12Q2600/158G01N33/57407G01N33/57484
Inventor 龚艳萍朱精强李志辉
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com